View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1866_low_18 (Length: 242)
Name: NF1866_low_18
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1866_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 25 - 216
Target Start/End: Original strand, 13021547 - 13021737
Alignment:
| Q |
25 |
ttgggatttctattctagtatatagacatttatgatgcagatttagataacgactgtttannnnnnnaaaagtttgaatatttgcttccgctttacattg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
13021547 |
ttgggatttctattctagtatatagacatttatgatgcagatgtagataacgactgtttattgttttaaaaatttgaatatttgcttccgctttacattg |
13021646 |
T |
|
| Q |
125 |
cattaatgatacaagtttgaatgacactttccaattgcattcattttgtattactgcatttgattatagagtcaaatgaagtaatttttgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13021647 |
cattaatgatacaagtttgaatgacactttccaattgcattcattttgtattactgca-ttgattatagagtcaaatgaagtaatttttgca |
13021737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University