View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1866_low_19 (Length: 236)

Name: NF1866_low_19
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1866_low_19
NF1866_low_19
[»] chr2 (2 HSPs)
chr2 (1-169)||(7260858-7261026)
chr2 (188-220)||(7260807-7260839)


Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 7261026 - 7260858
Alignment:
1 tatcttcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7261026 tatcttcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgata 7260927  T
101 atccgcaattcgatcgatgttcatggagaaaggctcatggaccggtcagtttcttgctcacaaatgcaa 169  Q
    ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||    
7260926 atccgcaattcgaccgattttcatggagaaaggctcatggaccggtcagtttcttgatcacaaatgcaa 7260858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 7260839 - 7260807
Alignment:
188 tacatatgatttcacagttcatatcatagcaat 220  Q
    |||||||||||||||||||||||||||||||||    
7260839 tacatatgatttcacagttcatatcatagcaat 7260807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University