View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1866_low_19 (Length: 236)
Name: NF1866_low_19
Description: NF1866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1866_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 7261026 - 7260858
Alignment:
| Q |
1 |
tatcttcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7261026 |
tatcttcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgata |
7260927 |
T |
|
| Q |
101 |
atccgcaattcgatcgatgttcatggagaaaggctcatggaccggtcagtttcttgctcacaaatgcaa |
169 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7260926 |
atccgcaattcgaccgattttcatggagaaaggctcatggaccggtcagtttcttgatcacaaatgcaa |
7260858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 7260839 - 7260807
Alignment:
| Q |
188 |
tacatatgatttcacagttcatatcatagcaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7260839 |
tacatatgatttcacagttcatatcatagcaat |
7260807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University