View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18670_low_1 (Length: 362)
Name: NF18670_low_1
Description: NF18670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18670_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 21 - 345
Target Start/End: Original strand, 46998347 - 46998677
Alignment:
| Q |
21 |
atgtttcaacatgaatcttaacatttctttctaactatataacacccttcacctctacttttcccttttatttattttccttttcaaacacaaaaataaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46998347 |
atgtttcaacatgaatcttaacatttctttctaactatataacacccttcacctcttcttttcccttttatttattttccttttcaaacacaaaaataaa |
46998446 |
T |
 |
| Q |
121 |
atcagatatctctatgggtatgttgttgtattaccctgttcctattcttctttctttctcactttctttcgttgttccttctgttattacaatgttcaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46998447 |
atcagatatctctatgggtatgttgttgtattaccctgttcctattcttctttctttctcactttctttcgttgttccttctgttattacaatgttcaag |
46998546 |
T |
 |
| Q |
221 |
aaaaacattcactctct------tttgaatttgaatttgaatttgaatctcaccaccactacaactattactcaatctgactctgtttctggtttggctc |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46998547 |
aaaaacattcactctcttttgaatttgaatttgaatttgaatttgaatctcaccaccactacaactattactcaatctaactctgtttctggtttggctc |
46998646 |
T |
 |
| Q |
315 |
ttgtcactgccaccgcggataacaaccttcc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46998647 |
ttgtcactgccaccgcggataacaaccttcc |
46998677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University