View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18671_low_10 (Length: 296)
Name: NF18671_low_10
Description: NF18671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18671_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 282
Target Start/End: Complemental strand, 26568626 - 26568360
Alignment:
| Q |
16 |
ataagaaacagacatgagccttgaaagggaccgaaaacaaagaaccttaagtcgcgctatagttgttttcctttctcttttggcatttgaactaggactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568626 |
ataagaaacagacatgagccttgaaagggaccgaaaacaaagaaccttaagtcgcgctatagttgttttcctttctcttttggcatttgaactaggactt |
26568527 |
T |
|
| Q |
116 |
gatcggaagattatttctcagctatgtgaatcgactagaaaggacttcaaggtattgtagaactccttagccttttccacacaaaatgcatgccctgcat |
215 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568526 |
gatcagaaaattatttctcagctatgtgaatcgactagaaaggacttcaaggtattgtagaactccttagccttttccacacaaaatgcatgccctgcat |
26568427 |
T |
|
| Q |
216 |
tcttgatcaccactatttgagcattgtcccctaaatgcctgtgattcaaatccaatgagttcaagat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568426 |
tcttgatcaccactatttgagcattgtcccctaaatgcctgtgattcaaatccaatgagttcaagat |
26568360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 200 - 256
Target Start/End: Complemental strand, 1676679 - 1676623
Alignment:
| Q |
200 |
aatgcatgccctgcattcttgatcaccactatttgagcattgtcccctaaatgcctg |
256 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| || |||| ||||||| |
|
|
| T |
1676679 |
aatgcatgccctgcattcttgatgaccaccatttgagcattttcacctatatgcctg |
1676623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University