View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18671_low_13 (Length: 244)
Name: NF18671_low_13
Description: NF18671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18671_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 48952595 - 48952362
Alignment:
| Q |
10 |
catcatcatcatagtatattggacgacaaatataattttttaaatcaactttcatgaggcaaagccgcaaacgctacgatgcaatataaaaacaatgttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48952595 |
catcatcatcatagtatattggacgacaaatataattttttaaatcaactttcatgaggcaaagccgcaaacgctacgatgcaatataaaaacaatgttg |
48952496 |
T |
 |
| Q |
110 |
atacgttaaataactagtagccttgcttaatttatttaacatgatgtcactttacataaaaatagtattttcgtaaggacaatgtgcatatggtgttttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48952495 |
atacgttaaataactagtagccttgcttaatttatttaacatgatgtcactttccataaaaatagtattttcgtaaggacaatgtgcatatggtgt-ttt |
48952397 |
T |
 |
| Q |
210 |
tcatatgacttgactaaattatctacgattttttc |
244 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48952396 |
tcatatgacttgactaaattatctatgattttttc |
48952362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University