View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18671_low_14 (Length: 237)

Name: NF18671_low_14
Description: NF18671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18671_low_14
NF18671_low_14
[»] chr5 (1 HSPs)
chr5 (1-221)||(42642344-42642564)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42642564 - 42642344
Alignment:
1 gttttaaaatatcagtagaaactaaaaattatatcgttttcaacgttggcttaattggttttatcttaccactgaaacagttgagaaaattattttctct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42642564 gttttaaaatatcagtagaaactaaaaattatatcgttttcaacgttggcttaattggttttatcttaccactgaaacagttgagaaaattattttctct 42642465  T
101 acaataaattttgtggaaaatcaaattttcaatcatatgaagatctatannnnnnnnngttgataaaattatatgaagatctattgttgaatggttgann 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||||| ||||      
42642464 acaataaattttgtggaaaatcaaattttcaatcatatgaagatctatatttttttttgttgataaaattatacgaagatctattgttgaatgattgatt 42642365  T
201 nnnnnggctgtgactttttca 221  Q
         ||||||||||||||||    
42642364 tttttggctgtgactttttca 42642344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University