View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18671_low_15 (Length: 214)
Name: NF18671_low_15
Description: NF18671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18671_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 43 - 197
Target Start/End: Complemental strand, 34907661 - 34907507
Alignment:
| Q |
43 |
atgcctcctccagtttgcactacattttcattttctaatatactttttgatttgtttacctgcagccatcagtgtcaacgccattccaatctgcacaacc |
142 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34907661 |
atgcctcctccagtttgcattacattttcattttctaatatactttttgatttgtttacctgcagccatcagtgtcaacgccattccaatctgcacaacc |
34907562 |
T |
 |
| Q |
143 |
tgctcagtcaagtggcagtttttcctttagcaactttgcccggacacaatctggt |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34907561 |
tgctcagtcaagtggcactttttcctttagcaactttgcccggacacaacctggt |
34907507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University