View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18671_low_7 (Length: 391)
Name: NF18671_low_7
Description: NF18671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18671_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 56 - 144
Target Start/End: Original strand, 9439420 - 9439508
Alignment:
| Q |
56 |
gacatgctgagagagccatgaatgagatctacacaaggataatttaatgaaggttcacctgaaaagaattttagaccagatattccctc |
144 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| || ||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9439420 |
gacatgctgatagagccatgaatgagatctatacaatgagaatttgatgaaggttcgcctgaaaagaattttagaccagatattccctc |
9439508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 199 - 328
Target Start/End: Original strand, 9439522 - 9439651
Alignment:
| Q |
199 |
aagaattatgagaagaaagtgggagagaggaagatgatctgttacattagatttaaggataaaaagtggtgtctctgactctgaagagtaacctctggtt |
298 |
Q |
| |
|
||||||||| |||||||||||||||| |||||| ||||| | | | |||||||||||| ||| || ||| |||||||||| |||||||||||||||| |
|
|
| T |
9439522 |
aagaattatatgaagaaagtgggagagtggaagaggatctatcctaatggatttaaggatagaaaatgttgtatctgactctgcagagtaacctctggtt |
9439621 |
T |
|
| Q |
299 |
ttctcattccatttggttactatccaaata |
328 |
Q |
| |
|
|||| | || |||| |||||||||||||| |
|
|
| T |
9439622 |
ttcttctaccttttgcttactatccaaata |
9439651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University