View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18672_low_11 (Length: 393)

Name: NF18672_low_11
Description: NF18672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18672_low_11
NF18672_low_11
[»] chr2 (1 HSPs)
chr2 (40-76)||(26716537-26716573)


Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 76
Target Start/End: Complemental strand, 26716573 - 26716537
Alignment:
40 aatcgacaaaagaaatatgtaaaaaatagtacatagg 76  Q
    |||| ||||||||||||||||||||||||||||||||    
26716573 aatcaacaaaagaaatatgtaaaaaatagtacatagg 26716537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University