View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_11 (Length: 550)
Name: NF18674_high_11
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 61 - 118
Target Start/End: Complemental strand, 37499201 - 37499144
Alignment:
| Q |
61 |
taaagtaacattattaccatggtgcttgtgttaggttttaatggaacacgacttgacc |
118 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37499201 |
taaagaaacgttattaccatggtgtctgtgttaggttttaatggaacacgacttgacc |
37499144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 391 - 435
Target Start/End: Complemental strand, 37515020 - 37514976
Alignment:
| Q |
391 |
aagtagtttagaacctgattgtcatgattgtacttttccaaagca |
435 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
37515020 |
aagtagtttataacctgattgtccttgttgtacttttccaaagca |
37514976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University