View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_18 (Length: 492)
Name: NF18674_high_18
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 2e-69; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 332 - 486
Target Start/End: Original strand, 43326563 - 43326719
Alignment:
| Q |
332 |
ttctctaatacacactttttactatcgttttatcaattaaaaatcgtgagtttcataagatttattagagacttacatgatttgatttgattgagctcat |
431 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43326563 |
ttctcgaatacacactttttactatcgttttatcaattaaaaatcatgagtttcataagatttattagagacttacatgatttgatttgattgagctcat |
43326662 |
T |
|
| Q |
432 |
atgagttttataaataaa--agtgtgagtagtatgtgctaaagaatgtgatgatgtc |
486 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43326663 |
atgagttttacaaataaaagagtgtgagtagtatgtgctaaagaatgtgatgatgtc |
43326719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 166 - 268
Target Start/End: Original strand, 43326276 - 43326378
Alignment:
| Q |
166 |
tattataaaatatttagatannnnnnnaagggaaaatatttacgtattaatgagtttgatcaaaatatgatttatgatataatttgattaagatatcatt |
265 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43326276 |
tattataaaatatttagatatttttttaagggaaaatatttacgtattaatgagtttgatcaaaatatgatttatgatataatttgattaagatctcatt |
43326375 |
T |
|
| Q |
266 |
tgg |
268 |
Q |
| |
|
||| |
|
|
| T |
43326376 |
tgg |
43326378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 43326136 - 43326198
Alignment:
| Q |
18 |
gaagacatgttgagagattcgtaaaatttgtagcaagaaatggagttcatatgaaggatggtc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43326136 |
gaagacatgttgagagattcgtaaaatttgtagcaagaaatggagttcatatgaaggatggtc |
43326198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 211 - 244
Target Start/End: Original strand, 5908826 - 5908859
Alignment:
| Q |
211 |
attaatgagtttgatcaaaatatgatttatgata |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
5908826 |
attaatgagttggatcaaaatatgatttatgata |
5908859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 211 - 247
Target Start/End: Complemental strand, 41444441 - 41444405
Alignment:
| Q |
211 |
attaatgagtttgatcaaaatatgatttatgatataa |
247 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
41444441 |
attaatgggtttgatcaaaatatggtttatgatataa |
41444405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 211 - 244
Target Start/End: Original strand, 45601656 - 45601689
Alignment:
| Q |
211 |
attaatgagtttgatcaaaatatgatttatgata |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
45601656 |
attaatgagttggatcaaaatatgatttatgata |
45601689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University