View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_50 (Length: 357)
Name: NF18674_high_50
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 3228271 - 3228323
Alignment:
| Q |
1 |
gattactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3228271 |
gattactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat |
3228323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 2 - 53
Target Start/End: Original strand, 3338651 - 3338702
Alignment:
| Q |
2 |
attactttcttaaatgcatgcatttggctaatttttgtcgttgattcatgat |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3338651 |
attactttcttaaatgcatgcatttggctattttttttcgttgattcatgat |
3338702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University