View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_51 (Length: 351)
Name: NF18674_high_51
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 48159407 - 48159229
Alignment:
| Q |
18 |
attagaaaatggggtgaataggatgcttgttgttcttgaagattggagaaattcacgcataatccaattagttgccatactggtttctattttaatgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159407 |
attagaaaatggggtgaataggatgcttgttgttcttgaagattggagaaattcacgcataatccaattagttgccatactggtttctattttaatgatt |
48159308 |
T |
|
| Q |
118 |
gttccatcagctgatgctgttgatgcactcaaaacttgtgcttgtttgctcaaggaatgcaggtatgctactataccac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48159307 |
gttccatcagctgatgctgttgatgcactcaaaacttgtgcttgtttgctcaaggaatgcaggtatgctgctataccac |
48159229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 207 - 342
Target Start/End: Complemental strand, 48159204 - 48159069
Alignment:
| Q |
207 |
ttgccaaatgttagtagcagagattcaactctaacccccctacatataactctttaggtgtccccgcctatgccgccattgagctactcctccgatacag |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159204 |
ttgccaaatgttagtagcagatattcaactctaaaccacctacatataactctttaggtgtccctgcctatgccgccattgagctactcctccgatacag |
48159105 |
T |
|
| Q |
307 |
atataagtgtttgtttggttccacttgtagaattat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159104 |
atataagtgtttgtttggttccacttgtagaattat |
48159069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University