View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_63 (Length: 329)
Name: NF18674_high_63
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 18 - 319
Target Start/End: Original strand, 27745079 - 27745380
Alignment:
| Q |
18 |
ttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcgttcgtctctcacctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27745079 |
ttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcgttcgtctctcacctg |
27745178 |
T |
|
| Q |
118 |
ataggtcaccccctagaggactcggcaatacccttataaatggattccccactttcctctactctgatgtgaaagaccaccgcaaggaaaaaagttacag |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27745179 |
ataggtcaccccctagaggactcaacaatacccttataaatggattccccactttcctctactctgatgtgaaagaccaccgcaaggaaaaaagttacag |
27745278 |
T |
|
| Q |
218 |
cttagaatgtgctatttgcttgctagagttcgaggacgatagcatgcttcgtcttctaactatttgtttccatgttttccaccaagaatgtatcgaccta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27745279 |
cttagaatgtgctatttgcttgctagagttcgaggacgatagcatgcttcgtcttctaactatttgtttccatgttttccaccaagaatgtatcgaccta |
27745378 |
T |
|
| Q |
318 |
tg |
319 |
Q |
| |
|
|| |
|
|
| T |
27745379 |
tg |
27745380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 319
Target Start/End: Original strand, 32844759 - 32845060
Alignment:
| Q |
18 |
ttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcgttcgtctctcacctg |
117 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||| ||| ||||||| | ||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32844759 |
ttcagcgttgtgtatgtttgcaagtattgttttgctggctttttccacacttgggccttgcaacgcacgacctcaggttccctcgttcgtctctcacctg |
32844858 |
T |
|
| Q |
118 |
ataggtcaccccctagaggactcggcaatacccttataaatggattccccactttcctctactctgatgtgaaagaccaccgcaaggaaaaaagttacag |
217 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| || | ||||||||||||||||||||| |||||||||| || |||||||| ||||| || |
|
|
| T |
32844859 |
ataggtcaccctctagaggactcgataatacccttctagaaaaattccccactttcctctactcctccgtgaaagaccttcgtaaggaaaagagttatag |
32844958 |
T |
|
| Q |
218 |
cttagaatgtgctatttgcttgctagagttcgaggacgatagcatgcttcgtcttctaactatttgtttccatgttttccaccaagaatgtatcgaccta |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || || ||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
32844959 |
cttagaatgtgccatttgcttgctagagtttgatgatgatagcatgcttcgtctcctaaccatttgttgtcatgttttccaccaagaatgtattgaccta |
32845058 |
T |
|
| Q |
318 |
tg |
319 |
Q |
| |
|
|| |
|
|
| T |
32845059 |
tg |
32845060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University