View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_71 (Length: 291)
Name: NF18674_high_71
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 44728218 - 44728489
Alignment:
| Q |
1 |
gtttcataaattgtgtctttaatattgataatgctaacaggggatcttagtagaggaaatgaaaataatagaaagtagaaaggatcctaacctcggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44728218 |
gtttcataaattgtgtctttaatattgataatgctaacgggggatcttagtagaggaaatgaaaataatagaaagtagaaaggatcctaacctcagattt |
44728317 |
T |
 |
| Q |
101 |
taggtctatatcattatgtcatgtgattctcaaaatcattactaaaattatagccaacggaattaaaacccagcttcctatgattgacaatttcaaaatg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44728318 |
taggtctatatcattatgtgatgtgattctcaaaatcattactaaaattatagccaacagaattaaaacccagcttcctatgattgacaatttcaaaatg |
44728417 |
T |
 |
| Q |
201 |
cttttattcctaaaaggatatgcttatcattgataatgttctgattgatttttaatctttcaatgctttcaa |
272 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44728418 |
cttttattcctaaaaggctatgcttatcattgataatgttctgattgatttttaatctttccatgctttcaa |
44728489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University