View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18674_high_72 (Length: 286)

Name: NF18674_high_72
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18674_high_72
NF18674_high_72
[»] chr4 (2 HSPs)
chr4 (30-276)||(46221136-46221382)
chr4 (43-180)||(29830997-29831134)
[»] scaffold0077 (1 HSPs)
scaffold0077 (53-139)||(10435-10521)


Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 276
Target Start/End: Complemental strand, 46221382 - 46221136
Alignment:
30 aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46221382 aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa 46221283  T
130 cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46221282 cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt 46221183  T
230 gctagggagttgatgaaattactagattgatatgcacgtgatctgtg 276  Q
    | |||||||||||||||||||||||||||||||||||||||||||||    
46221182 gttagggagttgatgaaattactagattgatatgcacgtgatctgtg 46221136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 43 - 180
Target Start/End: Original strand, 29830997 - 29831134
Alignment:
43 aaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacagacg 142  Q
    ||||| ||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| || || ||| | || ||||||||||| | ||| ||     
29830997 aaacgacggtgtttggcagaaggagatattgatgggaggaaaatgtgagccgttggatttctcaggcgttattcattatgatattaacggaagacaaacc 29831096  T
143 cgtgaagttccgatcaggtctccacgcgctagtccttt 180  Q
     ||||||||||  |||||||||||||||||| ||||||    
29831097 ggtgaagttcctctcaggtctccacgcgctattccttt 29831134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0077 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0077
Description:

Target: scaffold0077; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 139
Target Start/End: Complemental strand, 10521 - 10435
Alignment:
53 gtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacag 139  Q
    |||||||||||   ||| |||||||| |  |||||||| |||||||||||||| ||||||||||| || || | ||| |||||||||    
10521 gtttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacag 10435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University