View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_8 (Length: 649)
Name: NF18674_high_8
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 214 - 448
Target Start/End: Original strand, 12514832 - 12515066
Alignment:
| Q |
214 |
agtcaaatggaatctaaagaaggtgatgagagnnnnnnngaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtcttaa |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514832 |
agtcaaatggaatccaaagaaggtgatgagagaaaaaaagaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtcttaa |
12514931 |
T |
 |
| Q |
314 |
tgtttattggatctattggagccattgttcatggtgcttctgttcctattttctttattttctttggaaagttgatcaatgttattggcttggcttatct |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514932 |
tgtttattggatctattggagccattgttcatggtgcttctgttcctattttctttattttctttggaaagttgatcaatgttattggcttggcttatct |
12515031 |
T |
 |
| Q |
414 |
tttccctaaggaagcctctcacaaagttgccaagg |
448 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12515032 |
tttccctaaggaagcctctcacaaagttgccaagg |
12515066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 12514632 - 12514749
Alignment:
| Q |
19 |
cccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcacttttctctctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12514632 |
cccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcactgttctctctt |
12514731 |
T |
 |
| Q |
119 |
tgcaaagtacattgcaaa |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12514732 |
tgcaaagtacattgcaaa |
12514749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 522 - 614
Target Start/End: Original strand, 12515140 - 12515232
Alignment:
| Q |
522 |
gatggtctgtaatacagagttcagtcgatagtctgatcaagaattgttccattcaaaattgtttcgatttaatggaactaacaaaaatacaat |
614 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12515140 |
gatggtctttaatacagagttcagtcgatagtctgatcaaaaattgttccattcagaattgtttcgatttaatggaactaacaaaaatacaat |
12515232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 341 - 448
Target Start/End: Original strand, 27718051 - 27718158
Alignment:
| Q |
341 |
ttcatggtgcttctgttcctattttctttattttctttggaaagttgatcaatgttattggcttggcttatcttttccctaaggaagcctctcacaaagt |
440 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||||| || | || ||||| | || |||||||| ||||| ||||| ||||| || ||| |||| |
|
|
| T |
27718051 |
ttcatggtgcatctgttcctgttttctttatcttctttgggaaaattattaatgtcgtaggtttggcttacctttttcctaaagaagcttcccaccaagt |
27718150 |
T |
 |
| Q |
441 |
tgccaagg |
448 |
Q |
| |
|
|||||||| |
|
|
| T |
27718151 |
tgccaagg |
27718158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University