View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_80 (Length: 254)
Name: NF18674_high_80
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_80 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 27305312 - 27305555
Alignment:
| Q |
11 |
gaagcataggtttgttgacttgttcaagaaaactttgtacattaaggaacttgatcaaatttggtaaactgattatatagtttattgcttcaccgaaata |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
27305312 |
gaagcatagatttgttgacttgttcaagaaaactttgtacattaaggaacttgatcaaatttggtaaactaattatgtagtttattgcttcaccgaaata |
27305411 |
T |
 |
| Q |
111 |
atttgttggttgatcttccgttgggtgggccgtcgtttcaattggtatcgcggtgatgagttattctataagtcgtttggatagattcttgttgtcataa |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27305412 |
atttgttggttgatctaccgttgggtgggccgtcgtttcaattggtatcacggtaatgagttattctataagtcgtttggatagattcttgttgttataa |
27305511 |
T |
 |
| Q |
211 |
gattggtgtttgacttggtcaaactgtattcaggtggtacacat |
254 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| |||| |||||| |
|
|
| T |
27305512 |
gattggtgtttgacatggccaaactgtattcaagtggcacacat |
27305555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University