View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_84 (Length: 241)
Name: NF18674_high_84
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 83 - 223
Target Start/End: Complemental strand, 40375916 - 40375776
Alignment:
| Q |
83 |
atatagcgtacagaacacaaaggtttgtgtcatgaactaaggtttggttttgaagctaccaccctatgctacaacaacaatagttaggaggaggaaagaa |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40375916 |
atatagcgtacacaacacaaaggtttgtgtcatgaactaaggtttggttttgaagctaccaccctatgctacaacaacaatagttaggaggagggaagaa |
40375817 |
T |
 |
| Q |
183 |
gaggagtgacacgcttcaaccataacttttcggttaaaagc |
223 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40375816 |
gaggagggacacgcttcaaccataacttttcggttaaaagc |
40375776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University