View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_high_87 (Length: 236)
Name: NF18674_high_87
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_high_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 38998455 - 38998628
Alignment:
| Q |
1 |
gttcttataaggatcatgttggccttttgtcttcggttggtgctaataggccactctaggatgaagtaacggttacttggtttatgatttgcttattctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38998455 |
gttcttataaggatcatgttggccttttgtcttcggttggtgctcataggccactctaggatgaagtaacggttacttggtttatgatttgcttattctt |
38998554 |
T |
|
| Q |
101 |
caatataaaaaacttgatagggatgcttgcagaactgattaaatttgttgtggcataaggatgaagagtaggaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38998555 |
caatataaaaaacttgatagggatgcttgcagaactgattaaatttgttgttgcataaggatgaagagtaggaa |
38998628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 38998648 - 38998695
Alignment:
| Q |
173 |
aattggaagttcattatgaggaaaatgaataatttttagggagaaaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38998648 |
aattggaagttcattatgaggaaaatgaataatttttagggagaaaga |
38998695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University