View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_104 (Length: 214)
Name: NF18674_low_104
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_104 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 43 - 194
Target Start/End: Original strand, 33411494 - 33411646
Alignment:
| Q |
43 |
gttttcatttgtttttatttaaccacgtggacgatatgtgattttagaaagnnnnnnn-tatttgaagcaatttggcaataaacaaatatgcaatttagt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33411494 |
gttttcatttgtttttatttaaccacgtggacgatatgtgattttagaaagaaaaaaaatatttgaagcaatttggcaataaacaaatatgcaatttagt |
33411593 |
T |
 |
| Q |
142 |
gtggaccgtgtcaaagggaaatagaaaaagtatatagttgctcttccggcctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33411594 |
gtggaccgtgtcaaagggaaatagaaaaagtatatagttgttcttccggcctt |
33411646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 33425272 - 33425337
Alignment:
| Q |
112 |
atttggcaataaacaaatatgcaatttagtgtggaccgtgtcaaagggaaatagaaaaagtatata |
177 |
Q |
| |
|
|||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33425272 |
atttggcagtaaacaagtatgcaatatagtgtggaccgtgtcaaagggaaatagaaacagtatata |
33425337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 101 - 175
Target Start/End: Original strand, 33417150 - 33417228
Alignment:
| Q |
101 |
tatttgaagcaatttggcaa-taaacaaatatgcaattt---agtgtggaccgtgtcaaagggaaatagaaaaagtata |
175 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
33417150 |
tatttgaagcgatttggcaaataaacaaatatgtaattttagagagtggaacgtgtcaaagggaaatagaaaaagtata |
33417228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University