View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_105 (Length: 214)
Name: NF18674_low_105
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 38454703 - 38454526
Alignment:
| Q |
23 |
ataaccatgattaaaagaatagaaaaggagatcgacctaagcaatggggcaaacgcaaaccactttaccctgtactgtagtttgttttctgtgttggtag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
38454703 |
ataaccatgattaaaagaatagaaaaggagatcgacctaagcaatggggtaaacgcaaaccactttactctgtactgtagtttcttttctctgttggtag |
38454604 |
T |
|
| Q |
123 |
aaagtagcaacgttatgtacc-nnnnnnnngtagaaacgttgctattatttatttattttaattaatgctcttctgtg |
199 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454603 |
aaagtagcaacgttatgtaccaaaaaaaaagtagcaacgttgctattatttatttattttaattaatgctcttctgtg |
38454526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University