View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_108 (Length: 209)
Name: NF18674_low_108
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_108 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 5 - 195
Target Start/End: Complemental strand, 16624754 - 16624564
Alignment:
| Q |
5 |
aagaagtatgaagattctaaatagattatgtagattatgtaaaaataataaaaatcactgtctttttgtttcaatttgagccatgtattaattttatatc |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16624754 |
aagaagtatgaagattctaaataggttatgtagattatgtaaaaataataaaaatcactgtctttttgtttcaatttgagccatgtattaattttatatc |
16624655 |
T |
|
| Q |
105 |
atcaattatcaatcagttttctagtcttagtgcaaattaaaataatctcacgttattataactaatggaaatactttctaaacattgtctt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16624654 |
atcaattatcaatcagttttctagtcttagtgcaaattaaaataatctcacgttattgtaactaatggaaatactttctaaacattgtctt |
16624564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University