View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_44 (Length: 388)
Name: NF18674_low_44
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 24 - 343
Target Start/End: Complemental strand, 49038638 - 49038319
Alignment:
| Q |
24 |
ggcatatcctgcattctgccagcttcccggaacatttgatacccatcttcaacaaagaatgatcgactactgcgctagtcacctccgaggacgcagcctg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49038638 |
ggcatatcctgcattctgccagcttcccggaacatttgatacccatcttcaacaaagaatgatcgactgctgcgctagtcacctccgaggacgcagcctg |
49038539 |
T |
 |
| Q |
124 |
catcgcacggtttctgctttcaatcgcagcttctaacgtcgattcagtgagcaaccgatcaaccaataaatcaaagtgatcccccatctttgcacaatta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038538 |
catcgcacggtttctgctttcaatcgcagcttctaatgtcgattcagtgagcaaccgatcaaccaataaatcaaagtgatcccccatctttgcacaatta |
49038439 |
T |
 |
| Q |
224 |
aacaccacaatccactttactctcccaaacaagggaatgaattctatattgagtctacctaattctctatgtcaagtaaagttccttcgtatttctgaaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49038438 |
aacaccacaatccactttactctcccaaacaagggaatgaattctatattgagtctacctaattctctatgtcaagtaaagttccttcgtatttctgaaa |
49038339 |
T |
 |
| Q |
324 |
atgaaaaaccatatagaagg |
343 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
49038338 |
atgaaaaaccatataaaagg |
49038319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University