View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_78 (Length: 286)
Name: NF18674_low_78
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_78 |
 | |
|
| [»] scaffold0077 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 276
Target Start/End: Complemental strand, 46221382 - 46221136
Alignment:
| Q |
30 |
aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221382 |
aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa |
46221283 |
T |
|
| Q |
130 |
cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221282 |
cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt |
46221183 |
T |
|
| Q |
230 |
gctagggagttgatgaaattactagattgatatgcacgtgatctgtg |
276 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221182 |
gttagggagttgatgaaattactagattgatatgcacgtgatctgtg |
46221136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 43 - 180
Target Start/End: Original strand, 29830997 - 29831134
Alignment:
| Q |
43 |
aaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacagacg |
142 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| || || ||| | || ||||||||||| | ||| || |
|
|
| T |
29830997 |
aaacgacggtgtttggcagaaggagatattgatgggaggaaaatgtgagccgttggatttctcaggcgttattcattatgatattaacggaagacaaacc |
29831096 |
T |
|
| Q |
143 |
cgtgaagttccgatcaggtctccacgcgctagtccttt |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| |
|
|
| T |
29831097 |
ggtgaagttcctctcaggtctccacgcgctattccttt |
29831134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0077 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 139
Target Start/End: Complemental strand, 10521 - 10435
Alignment:
| Q |
53 |
gtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacag |
139 |
Q |
| |
|
||||||||||| ||| |||||||| | |||||||| |||||||||||||| ||||||||||| || || | ||| ||||||||| |
|
|
| T |
10521 |
gtttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacag |
10435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University