View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18674_low_84 (Length: 263)
Name: NF18674_low_84
Description: NF18674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18674_low_84 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 8316394 - 8316646
Alignment:
| Q |
11 |
gatggacatcatccattaccaagctcgacttagatgatattgatttatcatacaattataatccattgtgttcttattgtgaagaaatttgcactgatta |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8316394 |
gatggacatcatccatcaccaagctcgacttagatgatattgatttatcatacaattataatccattgtgttcttattgcgaagaaatttgcactgatta |
8316493 |
T |
|
| Q |
111 |
ttgctatgactatgataaggttagttttctccctcttgttatcttatttgatagtccaccccaaaacattgatgataaattaagtaactctgatgatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316494 |
ttgctatgactatgataaggttagttttctccctcttgttatcttatttgatagtccaccccaaaacattgatgataaattaagtaactctgatgatttt |
8316593 |
T |
|
| Q |
211 |
ggatgcagtataaattgactgtatgtccaaggtgtcatgtttgcggcaatcat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8316594 |
ggatgcagtataaattgactgtatgtccaaggtgtcatgtttgcggaaatcat |
8316646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University