View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18675_low_10 (Length: 278)
Name: NF18675_low_10
Description: NF18675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18675_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 2115030 - 2114782
Alignment:
| Q |
12 |
tcatcaagtgcaatgagttttgtctagaggctaatgatggtaatttaagaagttgcatatcgaaagtttcgagtattttaagagcaagacttggtaggaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115030 |
tcatcaagtgcaatgagttttgtctagaggctaatgatggtaatttaagaagttgcatatcgaaagtttcgagtattttaagagcaagacttggtaggaa |
2114931 |
T |
 |
| Q |
112 |
gaatgctggtcataaggataatcataatatgctaggatttgagtattcattaccttttccaaggaacgcatattttgttggaagagagaaagagattatg |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2114930 |
gaatgttggtcataaggataatcataatatgctaggatttgagaattcattaccttttccgaggaatgcatattttgttggaagagagaaagagattatg |
2114831 |
T |
 |
| Q |
212 |
gaaattgaaggtttactttttggaagtaggaattgttgtgtggaacaac |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2114830 |
gaaattgaaggtttactttttggaagtaggaattgttgtgtggaacaac |
2114782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University