View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18675_low_15 (Length: 242)

Name: NF18675_low_15
Description: NF18675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18675_low_15
NF18675_low_15
[»] chr1 (1 HSPs)
chr1 (24-199)||(44949565-44949738)
[»] scaffold1990 (1 HSPs)
scaffold1990 (183-222)||(936-975)
[»] scaffold0119 (1 HSPs)
scaffold0119 (183-226)||(1077-1120)
[»] scaffold0092 (1 HSPs)
scaffold0092 (183-222)||(47331-47370)
[»] chr6 (3 HSPs)
chr6 (183-226)||(26669673-26669716)
chr6 (183-222)||(31761196-31761235)
chr6 (194-226)||(32142033-32142065)
[»] chr4 (1 HSPs)
chr4 (184-223)||(15638727-15638766)
[»] chr2 (2 HSPs)
chr2 (183-221)||(6952315-6952353)
chr2 (194-226)||(20497192-20497224)
[»] chr7 (1 HSPs)
chr7 (184-225)||(24030024-24030065)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 24 - 199
Target Start/End: Complemental strand, 44949738 - 44949565
Alignment:
24 caaaactcacgaaacatttaacactattgacacacccaaattttcttaaaagtgaaaaactaggaattgggggtttggaccggccctttcataccgcgac 123  Q
    |||||||||| |||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
44949738 caaaactcacaaaacatttaacactat-gacacacccaaatctccttaaaagtgaaaaactaggaattgggggtttgaaccggcccttacataccgcgac 44949640  T
124 gttcgtctcaactgagttagattcacatggatcattgtacgactatttttgttatttgtgtgaataaatagggtgt 199  Q
    |||||||||||||||||||||||||| |||||||||||||||| |||||| || ||||||||||||||| ||||||    
44949639 gttcgtctcaactgagttagattcacgtggatcattgtacgaccattttt-ttttttgtgtgaataaatggggtgt 44949565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1990 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1990
Description:

Target: scaffold1990; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 975 - 936
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccct 222  Q
    |||||||| | |||||||||||||||||||||||||||||    
975 gtgaataagtggggtgtctgggattcgaaccccagcccct 936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 1120 - 1077
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccctacat 226  Q
    |||||||| | ||||||||||| |||||||||||||||||||||    
1120 gtgaataagtggggtgtctggggttcgaaccccagcccctacat 1077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 47331 - 47370
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccct 222  Q
    |||||||| | |||||||||||||||||||||||||||||    
47331 gtgaataagtggggtgtctgggattcgaaccccagcccct 47370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 26669673 - 26669716
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccctacat 226  Q
    |||||||| | ||||||||||| |||||||||||||||||||||    
26669673 gtgaataagtggggtgtctggggttcgaaccccagcccctacat 26669716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 183 - 222
Target Start/End: Complemental strand, 31761235 - 31761196
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccct 222  Q
    |||||||| |||||||||||||||||||||||| ||||||    
31761235 gtgaataagtagggtgtctgggattcgaacccctgcccct 31761196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 32142033 - 32142065
Alignment:
194 gggtgtctgggattcgaaccccagcccctacat 226  Q
    ||||||||||| |||||||||||||||||||||    
32142033 gggtgtctggggttcgaaccccagcccctacat 32142065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 223
Target Start/End: Complemental strand, 15638766 - 15638727
Alignment:
184 tgaataaatagggtgtctgggattcgaaccccagccccta 223  Q
    ||||||||||||||||| || |||||||||||||||||||    
15638766 tgaataaatagggtgtccggaattcgaaccccagccccta 15638727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 6952353 - 6952315
Alignment:
183 gtgaataaatagggtgtctgggattcgaaccccagcccc 221  Q
    |||||||||| ||||||||||| ||||||||||||||||    
6952353 gtgaataaatggggtgtctggggttcgaaccccagcccc 6952315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 20497192 - 20497224
Alignment:
194 gggtgtctgggattcgaaccccagcccctacat 226  Q
    ||||||| |||||||||||||||||||||||||    
20497192 gggtgtccgggattcgaaccccagcccctacat 20497224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 24030065 - 24030024
Alignment:
184 tgaataaatagggtgtctgggattcgaaccccagcccctaca 225  Q
    ||||||||| ||||||||||| |||||||||| |||||||||    
24030065 tgaataaatggggtgtctggggttcgaaccccggcccctaca 24030024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University