View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18675_low_18 (Length: 230)
Name: NF18675_low_18
Description: NF18675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18675_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 27701426 - 27701313
Alignment:
| Q |
1 |
tttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgacaattaatattcttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27701426 |
tttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaaattaatattcttta |
27701327 |
T |
|
| Q |
101 |
atcttggcatgtga |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27701326 |
atcttggcatgtga |
27701313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University