View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18675_low_4 (Length: 469)
Name: NF18675_low_4
Description: NF18675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18675_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 228 - 448
Target Start/End: Complemental strand, 9831938 - 9831718
Alignment:
| Q |
228 |
tgaatgtatccacatgtgtttgtgtcatgtcagtatacaccttcaaccgaaagtgttaaatgtcgattgtgttgatgtgaatcacatgagcacaatgaat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
9831938 |
tgaatgtatccacatgtgtttgtgtcatgtcggtatacaccttcaatcgaaagtgttgaatgtcgattgttttgatttgaatcacatgagcacaatgaat |
9831839 |
T |
|
| Q |
328 |
gttttaaataaaggtctatgaatgcgatagatgccgcgacatctaagttttcaatgcctcggcaactataacctaaccgcgactgcaaccattacagcca |
427 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9831838 |
gttttaaataaagatctatgaatgcaatagatgccacgacatctaagttttcaatgcctcggcaactataacctaaccgcgactgcaaccattaccgcca |
9831739 |
T |
|
| Q |
428 |
ccacgatttaaaacggtatta |
448 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9831738 |
ccacgatttaaaacggtatta |
9831718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 9832172 - 9832010
Alignment:
| Q |
1 |
ccattttctgccatatcagataaaaattgaaaagaaaaatgtcagtcctctctagtttaaaatcacatctgttatattcctatgtcagaaattatacacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832172 |
ccattttctgccatatcagataaaaattgaaaagaaaaatgtcagtcctctctagtttaaaatcacatctgttatattcctatgtcagaaattatacacc |
9832073 |
T |
|
| Q |
101 |
ttaca--------tactacaatgtgttatttgaaaatatctttagaaaattttacatcttatg |
155 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832072 |
tcacatacattattactacaatgtgttatttgaaaatatctttagaaaattttacatcttatg |
9832010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University