View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18677_high_10 (Length: 208)
Name: NF18677_high_10
Description: NF18677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18677_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 24189307 - 24189483
Alignment:
| Q |
14 |
agaatatccgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcggagattcgcctagttgggatgccgtttgtgtc |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24189307 |
agaatatctgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcagagattcgcctagttgggatgccgtttgtgtc |
24189406 |
T |
 |
| Q |
114 |
agtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24189407 |
agtggcaaggactgattggatgtggaaagtgtttttaccagagggatcggaccgggatcatggcgcggttaatgtat |
24189483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 24179501 - 24179677
Alignment:
| Q |
14 |
agaatatccgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcggagattcgcctagttgggatgccgtttgtgtc |
113 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||||| || ||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
24179501 |
agaacatccgggttatcgggttaatattgatccaaccattcttcggtggagaagaacggacggaggcggagattaacctagttgggatgccatttgtgtc |
24179600 |
T |
 |
| Q |
114 |
agtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat |
190 |
Q |
| |
|
||||||| ||| || ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24179601 |
ggtggcaaagaccgactggatctggaaagtatttttaccagagggatcggaccgggatcatggtgcggttaatgtat |
24179677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 116 - 190
Target Start/End: Original strand, 24113052 - 24113126
Alignment:
| Q |
116 |
tggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat |
190 |
Q |
| |
|
|||| ||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24113052 |
tggcgaggacggattggatgtggaaagcgtttttaccggagggatcagaccgggatcatggcgcggttaatgtat |
24113126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 24152326 - 24152413
Alignment:
| Q |
102 |
gccgtttgtgtcagtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgta |
189 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| |||||| |||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24152326 |
gccgttggtgtctatggcaaggacggattggtggtggaaggtgtttttaccggagggatcaaaccgggatcatggcgccgttaatgta |
24152413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 189
Target Start/End: Original strand, 24169171 - 24169240
Alignment:
| Q |
120 |
aaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgta |
189 |
Q |
| |
|
|||||| |||||| |||||| ||||||| ||||||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
24169171 |
aaggacggattggtggtggaaggtgttttgaccggagggatcgaaccgggatcatggtgctgttaatgta |
24169240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University