View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18677_high_10 (Length: 208)

Name: NF18677_high_10
Description: NF18677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18677_high_10
NF18677_high_10
[»] chr6 (5 HSPs)
chr6 (14-190)||(24189307-24189483)
chr6 (14-190)||(24179501-24179677)
chr6 (116-190)||(24113052-24113126)
chr6 (102-189)||(24152326-24152413)
chr6 (120-189)||(24169171-24169240)


Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 24189307 - 24189483
Alignment:
14 agaatatccgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcggagattcgcctagttgggatgccgtttgtgtc 113  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
24189307 agaatatctgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcagagattcgcctagttgggatgccgtttgtgtc 24189406  T
114 agtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat 190  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
24189407 agtggcaaggactgattggatgtggaaagtgtttttaccagagggatcggaccgggatcatggcgcggttaatgtat 24189483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 24179501 - 24179677
Alignment:
14 agaatatccgtgttatcgggtcaatattgatccaaccgtttttcggaggagaagaacggacggaggcggagattcgcctagttgggatgccgtttgtgtc 113  Q
    |||| ||||| |||||||||| ||||||||||||||| || ||||| |||||||||||||||||||||||||||  ||||||||||||||| ||||||||    
24179501 agaacatccgggttatcgggttaatattgatccaaccattcttcggtggagaagaacggacggaggcggagattaacctagttgggatgccatttgtgtc 24179600  T
114 agtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat 190  Q
     ||||||| ||| || ||||| |||||||| |||||||| ||||||||||||||||||||||| |||||||||||||    
24179601 ggtggcaaagaccgactggatctggaaagtatttttaccagagggatcggaccgggatcatggtgcggttaatgtat 24179677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 116 - 190
Target Start/End: Original strand, 24113052 - 24113126
Alignment:
116 tggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgtat 190  Q
    |||| ||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||    
24113052 tggcgaggacggattggatgtggaaagcgtttttaccggagggatcagaccgggatcatggcgcggttaatgtat 24113126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 24152326 - 24152413
Alignment:
102 gccgtttgtgtcagtggcaaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgta 189  Q
    |||||| |||||  |||||||||| ||||||  |||||| ||||||||||||||||||||  |||||||||||||||| |||||||||    
24152326 gccgttggtgtctatggcaaggacggattggtggtggaaggtgtttttaccggagggatcaaaccgggatcatggcgccgttaatgta 24152413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 189
Target Start/End: Original strand, 24169171 - 24169240
Alignment:
120 aaggactgattggatgtggaaagtgtttttaccggagggatcggaccgggatcatggcgcggttaatgta 189  Q
    |||||| ||||||  |||||| ||||||| ||||||||||||| ||||||||||||| || |||||||||    
24169171 aaggacggattggtggtggaaggtgttttgaccggagggatcgaaccgggatcatggtgctgttaatgta 24169240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University