View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18677_high_7 (Length: 379)
Name: NF18677_high_7
Description: NF18677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18677_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 15 - 364
Target Start/End: Original strand, 32845776 - 32846122
Alignment:
| Q |
15 |
ctttcactatgaaaatatctaatattgttcccagcactgctgcaaaccacaaacagatccaatttttcgctcatatcagaaacagatgaaataatctgtt |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845776 |
ctttctctatgaaaatatctaatattgttcccagcactgc---aaaccacaaacagatccaatttttcgctcatatcagaaacagatgaaataatctgtt |
32845872 |
T |
 |
| Q |
115 |
aatctcttttgtatgttccccaaatcaaaaaccatacagtgagttgagaaacttcatactcaaaatctcaaatcaaaaaccctgattaatcagtggttac |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32845873 |
aatcttttttgtatgttccccaaatcaaaaaccatacagtgagttgagaaacttcatactcaaaatctcaaatcaaaaaccctaattaatcagtggttac |
32845972 |
T |
 |
| Q |
215 |
ctgaaagggatggtggtggaagatctggaggttgcagttgtaagttgtgttcttttttaagttcatttgaaattaagaaatatttgcactgtaacacctt |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845973 |
ctgaaagggatggtggtggcagatctggaggttgcagttgtaagttgtgttcttttttaagttcatttgaaattaagaaatatttgcactgtaacacctt |
32846072 |
T |
 |
| Q |
315 |
tatttttaccattgatttcattcagactttgttctaaattagtttaacat |
364 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32846073 |
tatttttaccattgatttcactcagactttgttctaaattagtttaacat |
32846122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University