View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18677_high_9 (Length: 218)
Name: NF18677_high_9
Description: NF18677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18677_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 47115472 - 47115268
Alignment:
| Q |
18 |
atcatagaggaccatg---ccatcgatcggagaggaactaatacttgtcatttctcgattcaaagtacctataccactcaacaaaa-ggaccttcaacct |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47115472 |
atcatagaggaccatgatgccatcgatcggagaggaactaatatttgtcatttctcgattcaaagtacctataccactcaacaaaaaggaccttcaacct |
47115373 |
T |
 |
| Q |
114 |
tttgagcgttagtggacgaaaatatgggtgtagaaatgctcgcataaaatcaaactttcacgtggatgatggctcatacactccttatgtattaccaatg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47115372 |
tttgagcattagtggacgaaaatatgggcgtagaaatgctcgcataaaatcaaactttcacgtggatgatggctcatacactccttatgtattaccaatg |
47115273 |
T |
 |
| Q |
214 |
tggtg |
218 |
Q |
| |
|
||||| |
|
|
| T |
47115272 |
tggtg |
47115268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University