View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_high_45 (Length: 340)
Name: NF18678_high_45
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_high_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 325
Target Start/End: Original strand, 26775471 - 26775774
Alignment:
| Q |
16 |
ctgattactcatacaaaccttttcccttttagtcttttggttgcgcaatatcttaactgctaaaccctccaaagattgcgcaatatcagttttatatatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26775471 |
ctgattactcatacaaaccttttcccttttagtctcttggttgcgcaatatcttaactgctaaaccctccaaagattgcgcaatatcagttttatatatt |
26775570 |
T |
|
| Q |
116 |
aaatgaatttgacatgtcatcaatccgtgtgatc-aactctgctatgccatgtcatcaatccgcaaaataaaaagtaccacaaacaataggggaattann |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26775571 |
aaatgaatttgacatctcatcaatccgtgtgatcaaactctgctatgccatgtcatcaatccgcaaaataaaaagtaccacaaacaataggggaattatt |
26775670 |
T |
|
| Q |
215 |
nnnnngacaggagctaacaataagtaactaacaacggtaatagtctatagtctatttatataataatgaatgaaagctttattcaactcagctgtgtgaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26775671 |
tttttgacaggagctaacaataagtaactaataacggta-------atagtctatttatataataatgaatgaaagctttattcaactcaactgtgtgaa |
26775763 |
T |
|
| Q |
315 |
acaagcaacat |
325 |
Q |
| |
|
||||||||||| |
|
|
| T |
26775764 |
acaagcaacat |
26775774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University