View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_high_72 (Length: 243)
Name: NF18678_high_72
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 51679666 - 51679450
Alignment:
| Q |
18 |
ggtacaataggtacttgaactgcttcacaatgcacacaacttctacatcttctttcacactttggaggccttgaccctatttgaagtttctctgctaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51679666 |
ggtacaataggtacttgaactgcttcacaatgcacacaacttctacatcttctttcacactttggaggccttgaccctatttgaagtttctctgctaaca |
51679567 |
T |
 |
| Q |
118 |
ttgatccattctcttccatgccattctgcacatgcataaatatatattgagatatggagctatagagatatnnnnnnntatatatgatttatgaatttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51679566 |
ttgatccattctcttccatgccattctgcacatgcataaatatatattgagatatggagctatagagatataaaaaaatatatatgatttatgaatttga |
51679467 |
T |
 |
| Q |
218 |
tattgtaatacctttgc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
51679466 |
tattgtaatacctttgc |
51679450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University