View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_43 (Length: 357)
Name: NF18678_low_43
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 7910945 - 7911295
Alignment:
| Q |
1 |
ttatgggcatggactctacaaactcctttgcttctttcaagaaccctgcacgacccagaaggtctaccatgcatccataatgttccataacaggtttcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910945 |
ttatgggcatggactctacaaactcctttgcttctttcaagaaccctgcgcgacccagaaggtctaccatgcatccataatgttccataacaggtttcat |
7911044 |
T |
 |
| Q |
101 |
gttataaaaagtactcatgctctcaaacagggactttccttcttcaactaaccctgtatgactacatgctgtcaaaactgcagtgaaagtgaacgaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7911045 |
gttataaaaagtactcatgctctcaaacagggactttccttcttcaactaaccctgtatgactacatgctgtcaaaactgcagtgaaagtgaacgaagtt |
7911144 |
T |
 |
| Q |
201 |
ggcttaattcctgctttctgcatttgggtgaaccaatctaaagcttcgcttccctttccatgaactgcaaagccaccgattattgcagtccatgtataga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7911145 |
ggcttaattcctgctttctgcatttgggtgaaccaatctaaagcttcgcttccctttccatgaactgcaaagccaccgattattgcagtccatgtataga |
7911244 |
T |
 |
| Q |
301 |
cacatttcttctccaacttactgaacactagtaaggcttttttcatctcac |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7911245 |
cacatttcttctccaacttactgaacactagtaaggcttttttcatttcac |
7911295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University