View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_44 (Length: 351)
Name: NF18678_low_44
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 17 - 351
Target Start/End: Complemental strand, 52048725 - 52048391
Alignment:
| Q |
17 |
caatcaagctttgggaggacgccaaacaacaggttaggctgctatgcctgccacaatcaatttgtgacaattattaagctttagttttatttaattcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048725 |
caatcaagctttgggaggacgccaaacaacaggttaggctatgccgcctgccacaatcaatttgtgacaattattaagctttagttttatttaattcaat |
52048626 |
T |
 |
| Q |
117 |
taaattttaaaaaatacatattgcagatggtgaatgaagttgaaagctggccctatacttttcctgcttctgaggacttcctctcatctgcccaacgagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048625 |
taaattttaaaaaatacatattgcagatggtgaatgaagttgaaagctggccctatacttttcctgcttctgaggacttcctctcatctgcccaacgagg |
52048526 |
T |
 |
| Q |
217 |
taaagttgaaggtagattgcttgtccgagataggtaggtatcatattgccaagttttatcacattatgactcaaatataggtacatcacggttcactact |
316 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048525 |
taaatttgaaggtagattgcttgtccgagataggtaggtatcatattgccaagttttatcacattatgactcaaatataggtacatcacggttcactact |
52048426 |
T |
 |
| Q |
317 |
aaacttgtataggtacatcagggatgcattcgtcc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52048425 |
aaacttgtataggtacatcagggatgcattcgtcc |
52048391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University