View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_45 (Length: 341)
Name: NF18678_low_45
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_45 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 15 - 319
Target Start/End: Complemental strand, 28188 - 27884
Alignment:
| Q |
15 |
gacatcatctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188 |
gacatcagctttgaggtttataatttgttgaccaacttcagttttcttgtttataattcgtcaaacaaattcagttcacctgaaaaacggaacagatcag |
28089 |
T |
 |
| Q |
115 |
taattcgtaacgaacagtataacaataaaagattgttcctcaattcgacaggtgtgatacagtgggtggaagatgatttgccagttatatggaagcagcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28088 |
taattcgtaacgaacagtataacaataaaagattgttcctcaattccacaggtgtgatacagtgggtggaagatgatttgctagttatatggaagcagcc |
27989 |
T |
 |
| Q |
215 |
aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27988 |
aagaagcaaatgtttaacatataatgcttgtggaaactttgctagctgtaatgacgatgatagcgtttgcaaatgtttaccaggattctacaatgataac |
27889 |
T |
 |
| Q |
315 |
caggg |
319 |
Q |
| |
|
||||| |
|
|
| T |
27888 |
caggg |
27884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University