View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_61 (Length: 273)
Name: NF18678_low_61
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 39177753 - 39177994
Alignment:
| Q |
17 |
catttactataatcaactaatcatgttacattgaggacatactggatagataacaannnnnnnnnnnnnatagttgttttctgctcttccgtcggtgagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
39177753 |
catttactataatcaactaatcatgttacattgaggacatactggatggataacaatttttttttt---atagttgttttctgctcttccgtcagtgagg |
39177849 |
T |
|
| Q |
117 |
tggcaaatagatcctcaaatgcgacgtaaagatctcttttctcctttctcatatccagtggcatgccctctcctttgaacttcctcacttgctttggatt |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39177850 |
tggcaaatagaacctcaaatgcgacgtaaagatctcttttctcctttctcatatccagtggcat-ccctctcctttgaacttcctcacttgctttggatt |
39177948 |
T |
|
| Q |
217 |
tgtgtttctctaagggttcaaagaagtatgtcagatctgcgccttt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39177949 |
tgtgtttctctaagggttcaaagaagtatgtcagatctgcgccttt |
39177994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 153 - 230
Target Start/End: Original strand, 39168178 - 39168256
Alignment:
| Q |
153 |
ttttctcctttctcatatccagtggcatgccctctcctttgaacttcctcac-ttgctttggatttgtgtttctctaag |
230 |
Q |
| |
|
||||||| ||||||||| ||||| ||||||||||||| |||||||| |||| |||||||||||||||| ||| ||||| |
|
|
| T |
39168178 |
ttttctcttttctcataagcagtgacatgccctctcctctgaacttcttcactttgctttggatttgtgattccctaag |
39168256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 129 - 238
Target Start/End: Complemental strand, 44691574 - 44691465
Alignment:
| Q |
129 |
cctcaaatgcgacgtaaagatctcttttctcctttctcatatccagtggcatgccctctcctttgaacttcctcacttgctttggatttgtgtttctcta |
228 |
Q |
| |
|
||||||| | |||||||||||||| ||||| | | ||| ||| || |||||| ||||| ||||||||||||||||||||||| ||||||||| ||| || |
|
|
| T |
44691574 |
cctcaaaagtgacgtaaagatctcctttcttcgtgctcgtatgcaatggcataccctcccctttgaacttcctcacttgcttcggatttgtgattccctg |
44691475 |
T |
|
| Q |
229 |
agggttcaaa |
238 |
Q |
| |
|
|||| ||||| |
|
|
| T |
44691474 |
agggatcaaa |
44691465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University