View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_68 (Length: 249)
Name: NF18678_low_68
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 3 - 156
Target Start/End: Complemental strand, 17595893 - 17595740
Alignment:
| Q |
3 |
ataaattaaattaagtgacgacaaaaataattttctttaaaataaaatcccttgttattgattttttgttttgctaatgaatgcattgtaannnnnnnna |
102 |
Q |
| |
|
|||||| || ||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17595893 |
ataaatcaagttaagggacgacgaaaataattttgtttaaaataaaatcccttgttattgattttttgttttgctaatgaatgcattgtaatttttttaa |
17595794 |
T |
 |
| Q |
103 |
aaagcacatgaagctcaaagggtaacaaaaggttttatcaagtaacaataatgt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595793 |
aaagcacatgaagctcaaagggtaacaaaaggttttatcaagtaacaataatgt |
17595740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 17595752 - 17595684
Alignment:
| Q |
174 |
gtaacaataatgtgtatatacaagtaaatgaataatacctttctatcccatccaatgtttagtataatc |
242 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17595752 |
gtaacaataatgtatatatacaaagaaatgaataatacctttctatcccatccaatgtttagtacaatc |
17595684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University