View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_78 (Length: 224)
Name: NF18678_low_78
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 43589843 - 43589653
Alignment:
| Q |
18 |
ctacctctcatcgtgacaactgaaaatattttgaaccattgattttacttgtgattgtaaatgaatgaatggaattactttgctaattgctggtaaaatc |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43589843 |
ctacctctcatcgtgacaactaaaaatattttgaaccattgattttacttgtgtttgtaaatgaatgaatggaattactttgctaattgctggtaaaatc |
43589744 |
T |
|
| Q |
118 |
gctttgtattatgaacttaccttaaaaaccactcatagtcattgcgagaaagccaaatctaatccaacaaacaggatatgccaattcttcatctcac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43589743 |
gctttgtattatgaacttaccttaaaaaccac------tcattgcgagaaagccaaatctaatccaacaaacaggatatgccaattcttcatatcac |
43589653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University