View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_79 (Length: 221)
Name: NF18678_low_79
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_79 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
| [»] scaffold0316 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0029 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (2 HSPs) |
 |  |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 34)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19089552 - 19089610
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19089552 |
tctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaagc |
19089610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 6606153 - 6606095
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
6606153 |
tctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
6606095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14783476 - 14783418
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
14783476 |
tctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
14783418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5253279 - 5253221
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
5253279 |
tctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaaagc |
5253221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 9633681 - 9633623
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
9633681 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
9633623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 21898702 - 21898760
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
21898702 |
tctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
21898760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 34954675 - 34954617
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
34954675 |
tctacgcatgagccagattagtcgtccacctttgatgggtcggaaaccaatgcgaaagc |
34954617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 3601147 - 3601196
Alignment:
| Q |
10 |
gagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
3601147 |
gagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
3601196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 8938765 - 8938822
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
8938765 |
tctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaaag |
8938822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3588001 - 3587943
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| ||| |||||||| ||||||||||| |
|
|
| T |
3588001 |
tctacgcatgaaccggattagtcgtcaacctttgatggatcggaaactgatgcgaaagc |
3587943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 8612030 - 8611972
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
8612030 |
tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
8611972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 13036060 - 13036002
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
13036060 |
tctacgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcgaaagc |
13036002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 30788909 - 30788851
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||| ||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
30788909 |
tctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
30788851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 59
Target Start/End: Complemental strand, 13584497 - 13584444
Alignment:
| Q |
6 |
gcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
13584497 |
gcatgagccggattaatcgtccacctttggtgggtcggaaaccggcgcgaaagc |
13584444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8149853 - 8149797
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||| ||||| |||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
8149853 |
tctacgcattagccgaattagtcgtccacctttggtgggttggaaaccggtgcgaaa |
8149797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8932715 - 8932773
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| |||||||||||||| ||||||||| |
|
|
| T |
8932715 |
tctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc |
8932773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8944181 - 8944239
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| |||||||||||||| ||||||||| |
|
|
| T |
8944181 |
tctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc |
8944239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 29444821 - 29444775
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
29444821 |
tctacgcatgagccggattagttgtccatctttggtgggtcggaaac |
29444775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 30410499 - 30410557
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
30410499 |
tctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaagc |
30410557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 31129231 - 31129289
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||| ||||||||||| ||||||||| |
|
|
| T |
31129231 |
tctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc |
31129289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 9179792 - 9179747
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaa |
46 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
9179792 |
tctacgcatgagctggattagtcgtccacctttggtggatcggaaa |
9179747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29333195 - 29333138
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||| || ||||||| ||||||||| |||||| ||||| |||||||| |
|
|
| T |
29333195 |
tctacgcatgagccgaatcagtcgtccacctttggtaggtcggtaaccggtgcgaaag |
29333138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 2271359 - 2271312
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
2271359 |
tctacgcacgagccggattagtcgtccacctttgatgggtcagaaacc |
2271312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 32048511 - 32048550
Alignment:
| Q |
17 |
attagtcgtctacctttggtgggtcggaaaccgatgcgaa |
56 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
32048511 |
attagtcgtcaacctttgatgggtcggaaaccgatgcgaa |
32048550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8888936 - 8888993
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||| ||| ||||| |||||||||| |
|
|
| T |
8888936 |
tctacgcatgagtcggattagtcgtccacctttgatggatcgaaaacc-atgcgaaagc |
8888993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12606484 - 12606542
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||| | |||||||| ||||||||| |
|
|
| T |
12606484 |
tctacgcacgagccggattagtcgcccacctttggtgagctggaaaccggtgcgaaagc |
12606542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12635868 - 12635926
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||||||| | || |||||||||||||||||| ||||||||| |
|
|
| T |
12635868 |
tctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcgaaagc |
12635926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14107414 - 14107356
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | | || ||||||||||||||| ||||||||| |
|
|
| T |
14107414 |
tctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaagc |
14107356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14326051 - 14326109
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| || ||| ||||| |
|
|
| T |
14326051 |
tctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc |
14326109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14419061 - 14419119
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| || ||| ||||| |
|
|
| T |
14419061 |
tctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc |
14419119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 17114953 - 17114908
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaa |
46 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||| |
|
|
| T |
17114953 |
tctacgcatgagccggattagtcgcccacctttgataggtcggaaa |
17114908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 11142657 - 11142713
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||| | ||||||| ||| | ||||||||||||||| |||| ||||||| |
|
|
| T |
11142657 |
tctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa |
11142713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 15643890 - 15643842
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||| |||||||| |||||| |
|
|
| T |
15643890 |
tctacgcatgagtcggattagtcgcccacctttagtgggtcgaaaaccg |
15643842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 21167431 - 21167487
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||| ||||| | |||||| ||||||||| |
|
|
| T |
21167431 |
tacgcatgagccggattaatcgtccaccattgatgggttgaaaaccggtgcgaaagc |
21167487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 46)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 42086378 - 42086436
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
42086378 |
tctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
42086436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 9805055 - 9805113
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
9805055 |
tctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaagc |
9805113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 1538482 - 1538540
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
1538482 |
tctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaagc |
1538540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8513570 - 8513628
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
8513570 |
tctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
8513628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 23383708 - 23383766
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
23383708 |
tctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
23383766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 28857197 - 28857255
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28857197 |
tctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
28857255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 39099835 - 39099777
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| ||| ||||| |
|
|
| T |
39099835 |
tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagc |
39099777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 25950646 - 25950593
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
25950646 |
cgcatgagccggattagtcgtccacctttggtgggtcgaaaatcgatgcgaaag |
25950593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 27648481 - 27648424
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||| ||||||||||||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
27648481 |
tctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaaag |
27648424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 20525889 - 20525945
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| |||||||||| ||||||| |
|
|
| T |
20525889 |
tctacgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaaa |
20525945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 28857002 - 28857058
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28857002 |
tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
28857058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 9812923 - 9812981
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
9812923 |
tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
9812981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12705065 - 12705123
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
12705065 |
tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
12705123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 20255420 - 20255478
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||||||| | ||||||||| |
|
|
| T |
20255420 |
tctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc |
20255478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 41163516 - 41163458
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||| | ||||||||| |
|
|
| T |
41163516 |
tctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaaagc |
41163458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 42861274 - 42861216
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||||||| |||| ||||||||| |
|
|
| T |
42861274 |
tctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaagc |
42861216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 14588673 - 14588616
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | || |||||| |||||||| |
|
|
| T |
14588673 |
tctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcgaaag |
14588616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 36783296 - 36783352
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| |||||||| ||| ||||| |
|
|
| T |
36783296 |
tacgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcaaaagc |
36783352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 42291561 - 42291505
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||| |||||||||| ||||||| |
|
|
| T |
42291561 |
tctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa |
42291505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5731976 - 5731918
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
5731976 |
tctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
5731918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 9168309 - 9168251
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| ||| || ||| ||||| |
|
|
| T |
9168309 |
tctacgcatgagccggattagtcgtccacctttagtgggtcgaaaatcggtgcaaaagc |
9168251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12766182 - 12766240
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| || ||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
12766182 |
tctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
12766240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14728134 - 14728192
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||| ||||||||| |
|
|
| T |
14728134 |
tctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc |
14728192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19572775 - 19572833
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| ||||||| ||||||||| |
|
|
| T |
19572775 |
tctacgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcgaaagc |
19572833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 24653867 - 24653810
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||| |||||||||| ||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
24653867 |
tctacgcat-agccggattaatcgtccaccattggtgggtcgaaaaccgatgcgaaagc |
24653810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 40117466 - 40117524
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||| |||||| ||||||||| |
|
|
| T |
40117466 |
tctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaagc |
40117524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43399179 - 43399237
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||| |||||||||||| || |||||| |||||||||||| ||||||||| |
|
|
| T |
43399179 |
tctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc |
43399237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 2485247 - 2485304
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2485247 |
tctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag |
2485304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 14974380 - 14974343
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgg |
38 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14974380 |
tctacgcatgagccggattagtcgtccacctttggtgg |
14974343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 24875396 - 24875453
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||| ||||||||||| | ||||||||| |
|
|
| T |
24875396 |
tctacgcacgagccggattaatcgtccacctttgatgggtcggaaatcaatgcgaaag |
24875453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 15034126 - 15034182
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||||| ||| ||||||||||||| |||| |
|
|
| T |
15034126 |
tctacgcatgagcctgattagttgtccacctttgatggatcggaaaccgatgtgaaa |
15034182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 37263291 - 37263347
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||| ||| |||||||||| ||||||| |
|
|
| T |
37263291 |
tctacgcacgagccggattagtcgtccacctttattggatcggaaaccggtgcgaaa |
37263347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 38296783 - 38296728
Alignment:
| Q |
4 |
acgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| ||| ||||||||||| | ||||||| |||||||||||||||||| ||||| |
|
|
| T |
38296783 |
acgcacgagtcggattagtcgcccacctttgatgggtcggaaaccgatgcaaaagc |
38296728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3653970 - 3653912
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||||||| ||| |||||| ||| ||||| |
|
|
| T |
3653970 |
tctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgcaaaagc |
3653912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5079382 - 5079439
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||| ||||| |||||| ||||||||| |
|
|
| T |
5079382 |
tctacgcacgagccggattagtcgcccacctttggt-ggtcgaaaaccggtgcgaaagc |
5079439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 6764513 - 6764467
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
6764513 |
tctacgcacgagccggattagtcgcctatctttgttgggtcggaaac |
6764467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 13664311 - 13664369
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
13664311 |
tctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaaagc |
13664369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 14235770 - 14235712
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||| ||||||||||| ||||| |
|
|
| T |
14235770 |
tctaagcatgagtcggattagtcacccacctttggtgggtcagaaaccgatgcaaaagc |
14235712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20682673 - 20682615
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||| ||| | |||||| |||||| |||||||| ||||||||| |
|
|
| T |
20682673 |
tctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaagc |
20682615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 20692999 - 20693041
Alignment:
| Q |
16 |
gattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
20692999 |
gattagttgtccacctttggtgggtcggaaaccggtgcgaaag |
20693041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 21375402 - 21375460
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| | ||||| ||| ||||||||| ||||||||| |
|
|
| T |
21375402 |
tctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaaagc |
21375460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 38897775 - 38897717
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||| | | ||||||||||| ||||||||| ||||||||| |
|
|
| T |
38897775 |
tctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcgaaagc |
38897717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 7336671 - 7336708
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgg |
38 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
7336671 |
tctacgcacgagccggattaatcgtctacctttggtgg |
7336708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 18045690 - 18045746
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||| ||||||||| |||| ||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
18045690 |
tctacacatgagccg-attaatcgtccacctttagtggatcggaaaccgatgcgaaag |
18045746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 25417239 - 25417182
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||| | |||||||||||||| | |||| |||||||||| ||||||| |||||||| |
|
|
| T |
25417239 |
tctacgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcgaaag |
25417182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 40060339 - 40060391
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||| ||||| |||||||| ||||||| |
|
|
| T |
40060339 |
cgcatgagccggattaatcgtccaccattgatgggttggaaaccggtgcgaaa |
40060391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 51)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29127969 - 29128027
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
29127969 |
tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc |
29128027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 47471881 - 47471938
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47471881 |
tctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag |
47471938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 47219194 - 47219252
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
47219194 |
tctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtgcgaaagc |
47219252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 49021260 - 49021202
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
49021260 |
tctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
49021202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3136751 - 3136693
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
3136751 |
tctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaaagc |
3136693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 28572268 - 28572210
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
28572268 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
28572210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 8683291 - 8683242
Alignment:
| Q |
7 |
catgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaa |
56 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
8683291 |
catgagccggattagtcgtccacctttggtgggtcggaaacctatgcgaa |
8683242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 35316006 - 35316063
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||| |||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
35316006 |
tctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag |
35316063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 36043730 - 36043673
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
36043730 |
ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
36043673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 54261276 - 54261333
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
54261276 |
tctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag |
54261333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 7328895 - 7328951
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| |||||| ||||||||| |
|
|
| T |
7328895 |
tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc |
7328951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7310760 - 7310702
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
7310760 |
tctacgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaaagc |
7310702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 7650277 - 7650335
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||| |||||||| ||||||||| |
|
|
| T |
7650277 |
tctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc |
7650335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 15320236 - 15320294
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
15320236 |
tctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
15320294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 25295010 - 25295068
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| ||||||||| |||||||| ||||||||| |
|
|
| T |
25295010 |
tctatgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcgaaagc |
25295068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 45402408 - 45402350
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||| |||||| |||| |
|
|
| T |
45402408 |
tctacgcatgagccggattagtcgttcacctttagtgggtcggaaactgatgcgcaagc |
45402350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 47749162 - 47749104
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||| |||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
47749162 |
tctacgcacgagccgaattagtcgcccacctttggtaggtcggaaaccgatgcgaaagc |
47749104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 51060338 - 51060280
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| | |||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
51060338 |
tctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
51060280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 54237498 - 54237556
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| || ||||||||||||||| ||||||||| |
|
|
| T |
54237498 |
tctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaaagc |
54237556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 19147011 - 19147068
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||| ||| |||| |||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
19147011 |
tctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag |
19147068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29762212 - 29762155
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||| |||||||| |||||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
29762212 |
tctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag |
29762155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 45877504 - 45877561
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||| |||||||||||||| |||||||| |
|
|
| T |
45877504 |
tctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaaag |
45877561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 3507590 - 3507534
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
3507590 |
tctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa |
3507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49198401 - 49198457
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| || |||||||||| |||| |
|
|
| T |
49198401 |
tctacgcatgagccggattagtcgtccaccattggtggatcagaaaccgatgtgaaa |
49198457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 53649777 - 53649833
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| |||||||||| ||||||| |
|
|
| T |
53649777 |
tctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaaa |
53649833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 3755620 - 3755655
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3755620 |
tctacgcatgagccggattagtcgtctacctttggt |
3755655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 54448326 - 54448365
Alignment:
| Q |
18 |
ttagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54448326 |
ttagtcgtctacctttggtgggtcgaaaaccgatgcgaaa |
54448365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 11393526 - 11393476
Alignment:
| Q |
7 |
catgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
11393526 |
catgagccagattagtcgtccacctttgattggtcggaaaccgatgcgaaa |
11393476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 23511617 - 23511675
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||||| ||||||| |||||| ||||||||| |
|
|
| T |
23511617 |
tctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcgaaagc |
23511675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29135963 - 29136021
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||| || ||| ||||||||| |||||||| | ||||||| |
|
|
| T |
29135963 |
tctacgcatgagccggattagtcttccaccattggtgggttggaaaccggtacgaaagc |
29136021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 30767304 - 30767258
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30767304 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaaac |
30767258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 44064594 - 44064652
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
44064594 |
tctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc |
44064652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 22909833 - 22909890
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
22909833 |
tctacgcatgagccgaattagtcgtgcacctttgatgggtcggaaaccagtgcgaaag |
22909890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 34662376 - 34662320
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||| |||||||||| |||||||||| |||||| |||| | |||||||||||||||| |
|
|
| T |
34662376 |
tctatgcatgagccgaattagtcgtccacctttagtggattggaaaccgatgcgaaa |
34662320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 4638204 - 4638259
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaa |
56 |
Q |
| |
|
|||||||| ||||||||||||| | | |||||| ||||||||||||||||||||| |
|
|
| T |
4638204 |
tctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa |
4638259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 13367476 - 13367531
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| ||||| |||||||| |||||||| |
|
|
| T |
13367476 |
tacgcatgagccggattagtcacctaccgttgttgggtaggaaaccggtgcgaaag |
13367531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 7648790 - 7648848
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||| ||||||| || || |||||||||| |
|
|
| T |
7648790 |
tctacgcacgagccggattagtcgcccacctttgttgggtcgaaatccaatgcgaaagc |
7648848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 13893976 - 13894034
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| || ||||||||||||||| | ||||||||||| ||| |||||| ||||||||| |
|
|
| T |
13893976 |
tctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcgaaagc |
13894034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 19873422 - 19873468
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
19873422 |
tctacgcacgagccggattagtcgtccatcttttgtgggtcggaaac |
19873468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 26043862 - 26043920
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||||| |||||||| |
|
|
| T |
26043862 |
tctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccggggcgaaagc |
26043920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 26362024 - 26361966
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||||||||||| || |||||| |
|
|
| T |
26362024 |
tctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaaagc |
26361966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 33251712 - 33251758
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| ||||||| |||| |
|
|
| T |
33251712 |
tctacgcatgagccggattagtcgtccacatttgatgggtcgaaaac |
33251758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 41630569 - 41630523
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
||||| |||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
41630569 |
tctacacatgagccggattagtcgcccacctttggttggtcggaaac |
41630523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43330789 - 43330731
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||| |||||| | ||||||| |
|
|
| T |
43330789 |
tctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtacgaaagc |
43330731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 48342070 - 48342128
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| || ||||||||||| | ||||||||| |||||||| | ||||||||| |
|
|
| T |
48342070 |
tctacgcatgaaccagattagtcgtccatctttggtggatcggaaacaggtgcgaaagc |
48342128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 55069736 - 55069678
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
55069736 |
tctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgcaaaagc |
55069678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 928651 - 928708
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||| |||| ||| || ||||||||| |
|
|
| T |
928651 |
ctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcggtgcgaaagc |
928708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 10040606 - 10040659
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcg |
54 |
Q |
| |
|
|||||||| |||||||| | |||||| ||||||||||||| |||||||| |||| |
|
|
| T |
10040606 |
tctacgcacgagccggaatggtcgtccacctttggtgggttggaaaccggtgcg |
10040659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 32522031 - 32522076
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
32522031 |
tacgcatgagtcagattagtcgtccacctttgatgggtcggaaacc |
32522076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 50405660 - 50405612
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||| ||| ||||||||||| | ||| |||||||||||||||||| |
|
|
| T |
50405660 |
tctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccg |
50405612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 52364857 - 52364813
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaa |
45 |
Q |
| |
|
|||||||| |||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
52364857 |
tctacgcacgagctggattaatcgtctacctttgatgggtcggaa |
52364813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 46)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 14169665 - 14169608
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
14169665 |
tctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaag |
14169608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 25540460 - 25540402
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
25540460 |
tctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
25540402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3643943 - 3643885
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
3643943 |
tctacgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaaagc |
3643885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3811747 - 3811689
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
3811747 |
tctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaaagc |
3811689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 7747324 - 7747382
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
7747324 |
tctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
7747382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16325645 - 16325703
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
16325645 |
tctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
16325703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 20116668 - 20116610
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
20116668 |
tctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagc |
20116610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 22593184 - 22593241
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
22593184 |
tctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaagc |
22593241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39201564 - 39201516
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39201564 |
tctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccg |
39201516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10026672 - 10026626
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10026672 |
tctacgcatgagccggattagtcgaccacctttggtgggtcggaaac |
10026626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10046533 - 10046487
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10046533 |
tctacgcatgagccggattagtcgaccacctttggtgggtcggaaac |
10046487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10823110 - 10823168
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||| ||||||||||||||| ||||||||| |
|
|
| T |
10823110 |
tctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaagc |
10823168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 11069928 - 11069986
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||| | |||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
11069928 |
tctacgcacgagctgaattagtcgtccaccgttggtgggtcggaaaccgatgcgaaagc |
11069986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 18902586 - 18902528
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||| ||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
18902586 |
tctacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
18902528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 41220685 - 41220743
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
41220685 |
tctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
41220743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 6358207 - 6358150
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| |||||| || ||||| |
|
|
| T |
6358207 |
tctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccggtgtgaaag |
6358150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 58
Target Start/End: Original strand, 12864278 - 12864331
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
12864278 |
cgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag |
12864331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 35946788 - 35946845
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| |||||||||||||||| | |||||||| |
|
|
| T |
35946788 |
tctacgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag |
35946845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 38962813 - 38962870
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| ||||| | |||||||| |
|
|
| T |
38962813 |
tctacgcatgaaccggattagtcgtccacctttggtgggtcagaaactggtgcgaaag |
38962870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 331551 - 331598
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
331551 |
tctacgcatgagccggattagtcgcccacctttggtgggttggaaacc |
331598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8410181 - 8410239
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | || ||||| ||||||||||||| ||||||||| |
|
|
| T |
8410181 |
tctacgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaaagc |
8410239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12455360 - 12455418
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
12455360 |
tctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaagc |
12455418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 26805346 - 26805404
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||| | ||||||||||| ||| |||||||||| ||||| |
|
|
| T |
26805346 |
tctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccgatgcaaaagc |
26805404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 34130358 - 34130300
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| | ||||||| || ||||||||| |
|
|
| T |
34130358 |
tctacgcatgagccagattagtcgtctaccattggtagatcggaaatcggtgcgaaagc |
34130300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 38005452 - 38005510
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| |||||||||||||||||| | ||||||||||| |||||||| | ||||||||| |
|
|
| T |
38005452 |
tctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaagc |
38005510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 41031962 - 41031904
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
41031962 |
tctacgcacgagccggattagtcacccacctttggtgggtcggaaaccagtgcgaaagc |
41031904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 42770703 - 42770649
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
42770703 |
cgcacgagccggattaatcgtccacctttggtgggtcgaaaaccgatgcaaaagc |
42770649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 44139534 - 44139592
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||| ||||||||||||||||| ||||||||| |
|
|
| T |
44139534 |
tctacgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaaagc |
44139592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 44945643 - 44945701
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||| |||| |||||||||| ||||||||| |
|
|
| T |
44945643 |
tctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc |
44945701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 58
Target Start/End: Original strand, 792208 - 792261
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||||| ||| |||| |
|
|
| T |
792208 |
cgcatgagccggattagtcgcccatctttggtgggtcggaaaccggtgcaaaag |
792261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 2550918 - 2550975
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| | || |||||||||| | |||||| |||||||| |
|
|
| T |
2550918 |
tctacgcatgagccggattagtcgcccacttttggtgggttgaaaaccggtgcgaaag |
2550975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 20612591 - 20612534
Alignment:
| Q |
1 |
tctacgcatgagccgg-attagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
20612591 |
tctatgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa |
20612534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 1773700 - 1773644
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||||||||| |||||| ||||||| |
|
|
| T |
1773700 |
tctacgcatgagttggattagtcgtccaccattggtgggtcgaaaaccggtgcgaaa |
1773644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 29422267 - 29422323
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| ||| ||||||| || ||||||||| |
|
|
| T |
29422267 |
tacgcacgagccggattagtcgtccacctttgatggatcggaaatcggtgcgaaagc |
29422323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 44023347 - 44023403
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||| || |||||||||| | ||||||||||| |||||||| ||||||||| |
|
|
| T |
44023347 |
tacgcatgagtcgaattagtcgtccatctttggtgggttggaaaccggtgcgaaagc |
44023403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 24179618 - 24179657
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggt |
40 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
24179618 |
tctacgcatgagccggattagtcgtccatctttggtgggt |
24179657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 13026467 - 13026409
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||| | || |||||| |||| ||||||||||| ||||| |
|
|
| T |
13026467 |
tctacgcatgagccggattagtcagccacttttggtaggtcagaaaccgatgcaaaagc |
13026409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 34346343 - 34346285
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| | ||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
34346343 |
tctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc |
34346285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34722730 - 34722788
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||| ||| || ||||||| ||||||||| |
|
|
| T |
34722730 |
tctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaagc |
34722788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 37560223 - 37560281
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||| ||||||| |||||| || |||||| |
|
|
| T |
37560223 |
tctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtgtgaaagc |
37560281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 18649082 - 18649025
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||| |||||||| |||||||| |
|
|
| T |
18649082 |
tctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaaag |
18649025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 33005801 - 33005858
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||| | ||||| ||| |||||| |||||||||||||||||||||||| |
|
|
| T |
33005801 |
tctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag |
33005858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 44773321 - 44773370
Alignment:
| Q |
9 |
tgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
44773321 |
tgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag |
44773370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10669642 - 10669690
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||| ||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
10669642 |
tctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccg |
10669690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 21642000 - 21642056
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||||||||||| |||||| ||||||| |
|
|
| T |
21642000 |
tctacgcatgagccgaattaatcgcccgcctttggtgggtcgaaaaccggtgcgaaa |
21642056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 44548774 - 44548722
Alignment:
| Q |
7 |
catgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||| | ||||||||| |
|
|
| T |
44548774 |
catgagccagattagtcgtccacctttgatggatcggaaactggtgcgaaagc |
44548722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 47)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 6032699 - 6032643
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6032699 |
tctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaa |
6032643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 40780917 - 40780861
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
40780917 |
tctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa |
40780861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 7246702 - 7246645
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
7246702 |
tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
7246645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8889077 - 8889125
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8889077 |
tctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccg |
8889125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 4738673 - 4738731
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
4738673 |
tctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
4738731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16450355 - 16450413
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
16450355 |
tctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaagc |
16450413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 38075488 - 38075546
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| |||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38075488 |
tctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaagc |
38075546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 38166082 - 38166140
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
38166082 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
38166140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 52950137 - 52950195
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| ||||| || ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52950137 |
tctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaaagc |
52950195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 29895842 - 29895899
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| |||||||||| |||||||| |
|
|
| T |
29895842 |
tctacgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaaag |
29895899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 13073593 - 13073649
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
13073593 |
tctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa |
13073649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 48834750 - 48834698
Alignment:
| Q |
7 |
catgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
48834750 |
catgagtcggattagtcgcctacctttggtgggtcggaaaccggtgcgaaagc |
48834698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 6779266 - 6779324
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
6779266 |
tctatgcatgagccggattagtcgtccacctttggtgaatcggaacccgatgcgaaagc |
6779324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 38168311 - 38168369
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||| |||||||| ||||||||| |
|
|
| T |
38168311 |
tctacgcatgagccggattagtcgttcacctttagtgggttggaaaccggtgcgaaagc |
38168369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 47682438 - 47682380
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||| ||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
47682438 |
tctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
47682380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 2559362 - 2559419
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
2559362 |
tctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcgaaag |
2559419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 30317288 - 30317345
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| |||||| |||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
30317288 |
tctacgcacgagccgaattagtcgcccacctttggtgggtcggaaaccgatgtgaaag |
30317345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 31588741 - 31588798
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
31588741 |
tctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag |
31588798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 42722633 - 42722576
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| |||||| |||||||| |
|
|
| T |
42722633 |
tctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag |
42722576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 46108746 - 46108798
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgc |
53 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
46108746 |
tctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccgatgc |
46108798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 1940833 - 1940779
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcga |
55 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||| |||||| ||||| |
|
|
| T |
1940833 |
tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga |
1940779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5472904 - 5472846
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||| |||| | ||||||||| |
|
|
| T |
5472904 |
tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaactggtgcgaaagc |
5472846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 29588791 - 29588849
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||| || ||| ||||||||||||||| |||||||||||| |
|
|
| T |
29588791 |
tctacgcacgagccggattagttatccaccattggtgggtcggaaatcgatgcgaaagc |
29588849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 36145271 - 36145213
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| || |||||||||| ||||||||| |
|
|
| T |
36145271 |
tctacacatgagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaaagc |
36145213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 36262823 - 36262765
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||| ||||||||||| | |||||||||||||| |||||| |||||||||| |
|
|
| T |
36262823 |
tctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagc |
36262765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 38841424 - 38841366
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| | ||||||| | ||||||| |||||||||||| |
|
|
| T |
38841424 |
tctacgcatgagtcggattagtcgtccatctttggtagttcggaaatcgatgcgaaagc |
38841366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 49260721 - 49260663
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||||||| || ||| ||||| |
|
|
| T |
49260721 |
tctacgcacgagccggattagtcgaccacctttggtgggtcggaaatcggtgcaaaagc |
49260663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 50485998 - 50486056
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||| || ||||||||||||||||||| ||||| |
|
|
| T |
50485998 |
tctacgcacgagccggattagtcgcccaccattagtgggtcggaaaccgatgcaaaagc |
50486056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 53599115 - 53599173
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |||| |||||||||| ||||||||| |
|
|
| T |
53599115 |
tctacgcatgagccggattaatcgttcacctttagtggatcggaaaccggtgcgaaagc |
53599173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 55921089 - 55921147
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
55921089 |
tctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc |
55921147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 43458668 - 43458725
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||| | ||||||||||||||||| ||||||| || ||||||||||| |||||||| |
|
|
| T |
43458668 |
tctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaag |
43458725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 43468402 - 43468459
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| | ||| |||||||||||| |||| |||||||| |
|
|
| T |
43468402 |
tctacgcatgagccggattagtcgcccaccagtggtgggtcggagaccggtgcgaaag |
43468459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 54946304 - 54946352
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||||||||||||||||||| | | | |||||||||||||||||| |
|
|
| T |
54946304 |
tctacgcatgagccggattagtcgcccatcattggtgggtcggaaaccg |
54946352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 21429356 - 21429411
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaa |
56 |
Q |
| |
|
|||||||| ||| | || |||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
21429356 |
tctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcgaa |
21429411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3507325 - 3507371
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaac |
47 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
3507325 |
tctacacacgagccggattagtcgtccacctttggtggatcggaaac |
3507371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16645173 - 16645231
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| |||||| | ||||||||| | |||| ||||||||||||||||| ||||||||| |
|
|
| T |
16645173 |
tctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaagc |
16645231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 17080098 - 17080156
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| ||| |||||| ||||||||| |
|
|
| T |
17080098 |
tctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc |
17080156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 25406619 - 25406561
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| | |||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
25406619 |
tctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaaagc |
25406561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 26237476 - 26237422
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||| ||||||||| ||| ||| ||| |||||||||||| ||||||||| |
|
|
| T |
26237476 |
tacgcatgagtcggattagtagtccaccattgatgggtcggaaactgatgcgaaa |
26237422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 27531722 - 27531668
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||| ||| || |||||| |
|
|
| T |
27531722 |
cgcatgagtcggaatagtcgtccacctttggtgggtcggaagccggtgtgaaagc |
27531668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 47078513 - 47078571
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
47078513 |
tctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcgaaagc |
47078571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 49952202 - 49952144
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtct-acctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||||| |||||||| |||||||| |
|
|
| T |
49952202 |
tctacgcatgagccggattagtcgcgtcacctttgatgggttggaaaccggtgcgaaag |
49952144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 14 - 59
Target Start/End: Original strand, 4986261 - 4986306
Alignment:
| Q |
14 |
cggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| | ||||||||| |
|
|
| T |
4986261 |
cggattagtcgtctacctttgatgggtcagaaactggtgcgaaagc |
4986306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 14567294 - 14567351
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| || |||||||| |
|
|
| T |
14567294 |
tctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag |
14567351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 15829754 - 15829811
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||| |||||||||||||||||| || ||| ||||||| || ||||||| |||||||| |
|
|
| T |
15829754 |
tctaggcatgagccggattagtcctccaccattggtggatcagaaaccggtgcgaaag |
15829811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 20532465 - 20532420
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaa |
46 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||| ||||||| |
|
|
| T |
20532465 |
tctacgcatgagccggataagtcgcccacctttggtggatcggaaa |
20532420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 20128366 - 20128422
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| |||| ||||||||||| ||| |||||||||| ||||||| ||||||||| |
|
|
| T |
20128366 |
tacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaagc |
20128422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 27)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10927660 - 10927718
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
10927660 |
tctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc |
10927718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43027359 - 43027417
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
43027359 |
tctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaagc |
43027417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 4479352 - 4479296
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4479352 |
tctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa |
4479296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 26570978 - 26571036
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
| T |
26570978 |
tctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccgatgtgaaagc |
26571036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 15884612 - 15884556
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
15884612 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa |
15884556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8141156 - 8141214
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| | |||||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
8141156 |
tctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaagc |
8141214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 45521222 - 45521280
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
45521222 |
tctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaagc |
45521280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 6100527 - 6100584
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||| |||||| ||||||||| |
|
|
| T |
6100527 |
ctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccgctgcgaaagc |
6100584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 18374064 - 18374121
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||| |||||| ||| |||| |
|
|
| T |
18374064 |
tctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgcaaaag |
18374121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 8997598 - 8997542
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
8997598 |
tacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaagc |
8997542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 2467174 - 2467116
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| ||||||||||| ||||||||| |
|
|
| T |
2467174 |
tctatgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaaagc |
2467116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2964130 - 2964188
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| || |||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
2964130 |
tctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
2964188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3418569 - 3418511
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||| ||||||| ||||||| ||||||||| |
|
|
| T |
3418569 |
tctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcgaaagc |
3418511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8803108 - 8803166
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | | | ||||||||||||||||||||||||||| |
|
|
| T |
8803108 |
tctacgcacgagccggattagtcgcccatcaatggtgggtcggaaaccgatgcgaaagc |
8803166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 9860051 - 9859993
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| |||||||| ||||||||||| ||| ||||||| |||||||||||||| ||||| |
|
|
| T |
9860051 |
tctacacatgagccagattagtcgtccaccattggtggatcggaaaccgatgcaaaagc |
9859993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14846629 - 14846687
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| | ||| ||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
14846629 |
tctacgcatgagtcagataagtcgtccacctttggtgggtcggaaatcggtgcgaaagc |
14846687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43032955 - 43033013
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| || ||||||||||||||| | |||||||||||||| ||||||| ||||||||| |
|
|
| T |
43032955 |
tctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
43033013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 4772094 - 4772049
Alignment:
| Q |
14 |
cggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
4772094 |
cggattagtcgtccacctttggtgggtcggaaaccggtgcgtaagc |
4772049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 3379868 - 3379812
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||| ||||||| ||||||||||||| || |||||||||||||||| || ||||||| |
|
|
| T |
3379868 |
tctatgcatgagtcggattagtcgtccacttttggtgggtcggaaatcggtgcgaaa |
3379812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3567958 - 3568005
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
3567958 |
tctacgcatgagccaaattagtcatccacctttggtgggtcggaaacc |
3568005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 24837296 - 24837354
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| ||| |||| |||||||||||| ||||||||||| |||||||| | ||||||||| |
|
|
| T |
24837296 |
tctaagcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaagc |
24837354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 27975945 - 27976003
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||| |||||||||||| ||| | |||||| ||||||| | ||||||||||||||| |
|
|
| T |
27975945 |
tctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc |
27976003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 28033214 - 28033272
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||| |||||||||||| ||| | |||||| ||||||| | ||||||||||||||| |
|
|
| T |
28033214 |
tctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc |
28033272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 36662458 - 36662515
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||| |||| |||||||||||||| || ||| ||| ||||||||||||||||||| |
|
|
| T |
36662458 |
tctacgtatgaaccggattagtcgtccacttttaatggatcggaaaccgatgcgaaag |
36662515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 13358012 - 13357964
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13358012 |
tctatgcacgagccggattagtcgtccccctttagtgggtcggaaaccg |
13357964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 59
Target Start/End: Original strand, 16893993 - 16894047
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||| |||||||||| ||||||||| |
|
|
| T |
16893993 |
tacgcatgagccggatt-gtcgcccacctttggtgg-tcggaaaccggtgcgaaagc |
16894047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 24938618 - 24938570
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||| ||| |||||||||| |
|
|
| T |
24938618 |
tctacgcatgaaccggattagtcatccacctttgatggatcggaaaccg |
24938570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 41)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 28396214 - 28396168
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28396214 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
28396168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 48804736 - 48804794
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
48804736 |
tctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
48804794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 38578923 - 38578866
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
38578923 |
tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
38578866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 24983475 - 24983416
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtc-ggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
24983475 |
tctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaagc |
24983416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 4195258 - 4195200
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
4195258 |
tctacgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaagc |
4195200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 5069871 - 5069813
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
5069871 |
tctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc |
5069813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17748438 - 17748380
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| | ||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
17748438 |
tctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaagc |
17748380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 39420890 - 39420948
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||| ||| ||||| |
|
|
| T |
39420890 |
tctacgcatgagccggattagtcgtctacctttgatgggccggaaaccggtgcaaaagc |
39420948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 10047932 - 10047874
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| | |||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
10047932 |
tctacgcatgagcagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
10047874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 13095911 - 13095969
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
13095911 |
tctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc |
13095969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 22974020 - 22974078
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
22974020 |
tctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccggcgcgaaagc |
22974078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 39474993 - 39475051
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| ||||| ||||||||| |
|
|
| T |
39474993 |
tctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcgaaagc |
39475051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 42032149 - 42032207
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
42032149 |
tctacgcatgagccgaattagttgtccacctttgatgggtcggaaaccgatgctaaagc |
42032207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 48551910 - 48551968
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| ||| |||||||||| ||||||||| |
|
|
| T |
48551910 |
tctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagc |
48551968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 28744224 - 28744273
Alignment:
| Q |
10 |
gagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
28744224 |
gagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
28744273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 41945526 - 41945583
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |||||||| || |||||||| |
|
|
| T |
41945526 |
tctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag |
41945583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 8734739 - 8734684
Alignment:
| Q |
4 |
acgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| ||||| ||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
8734739 |
acgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
8734684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 1606002 - 1606052
Alignment:
| Q |
9 |
tgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||||| ||||||||| |
|
|
| T |
1606002 |
tgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaagc |
1606052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 59
Target Start/End: Original strand, 29152005 - 29152051
Alignment:
| Q |
13 |
ccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29152005 |
ccggattaatcgtctaccattgatgggtcggaaaccgatgcgaaagc |
29152051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 42210318 - 42210260
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||| || | ||| |||||||||||||||||||||||||||| |
|
|
| T |
42210318 |
tctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagc |
42210260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43862028 - 43861970
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| ||| |||||| ||||||||| |
|
|
| T |
43862028 |
tctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcgaaagc |
43861970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 48244412 - 48244354
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||| |||||| ||||||||| |
|
|
| T |
48244412 |
tctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgcgaaagc |
48244354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 3353477 - 3353534
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||| || ||||||| |||||||| |
|
|
| T |
3353477 |
tctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaag |
3353534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 27028332 - 27028389
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
27028332 |
tctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag |
27028389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 27875144 - 27875088
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||| || |||||||||| |||||| |||||||| |||||| ||||||| |
|
|
| T |
27875144 |
tctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaaa |
27875088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 36619310 - 36619270
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
36619310 |
tctacgcatgagccggattagtcgtccaccattggtgggtc |
36619270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 18785722 - 18785777
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaa |
56 |
Q |
| |
|
||||||||||| | ||||||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
18785722 |
tctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcgaa |
18785777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 59
Target Start/End: Complemental strand, 34127698 - 34127643
Alignment:
| Q |
4 |
acgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||||||| |||||| ||||||||| |
|
|
| T |
34127698 |
acgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtgcgaaagc |
34127643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41267980 - 41267929
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatg |
52 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
41267980 |
tctacgcatgagttagattagtcgtccacctttgatgggtcggaaaccgatg |
41267929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45697246 - 45697199
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
45697246 |
tctacgcatgagttgggttagtcgtccacctttggtgggtcggaaacc |
45697199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 14650370 - 14650428
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| | |||||| ||||||||| |
|
|
| T |
14650370 |
tctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccggtgcgaaagc |
14650428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22993423 - 22993365
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
22993423 |
tctacgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaagc |
22993365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 32768990 - 32769048
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||||| |||||||||| || |||||| |
|
|
| T |
32768990 |
tctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagc |
32769048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34659279 - 34659337
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | ||| |||||| |||| |||||| ||||||||| |
|
|
| T |
34659279 |
tctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcgaaagc |
34659337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 43925565 - 43925623
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||| || |||||||| ||| || |||||||||| |||||| |
|
|
| T |
43925565 |
tctacgcatgagctggattagttgtttacctttgatggatcagaaaccgatgtgaaagc |
43925623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 3603410 - 3603467
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||| |||| || |||||||||||||||| || |||||||| |
|
|
| T |
3603410 |
tctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaag |
3603467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 4706040 - 4705983
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||| | ||| ||||||||| ||||| |
|
|
| T |
4706040 |
tctacgcacgagctggattagtcgtccacctttggtagatcgaaaaccgatgtgaaag |
4705983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29805496 - 29805439
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
29805496 |
tctacgcatgagccaaattaatcgtctacctttagtgagtcggaaaccagtgcgaaag |
29805439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 30827345 - 30827378
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttg |
34 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
30827345 |
tctacgcacgagccggattagtcgtctacctttg |
30827378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5039474 - 5039426
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
5039474 |
tctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccg |
5039426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 26423343 - 26423288
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
26423343 |
tctacgcacgagccagattagtcgttcacctttggt-ggtcggaaaccggtgcgaaa |
26423288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 47)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 26325863 - 26325921
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
26325863 |
tctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
26325921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 9659234 - 9659178
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
9659234 |
tacgcatgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaagc |
9659178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 4581739 - 4581681
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||| |||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
4581739 |
tctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
4581681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5855573 - 5855631
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
5855573 |
tctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc |
5855631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 8764042 - 8764100
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
8764042 |
tctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaagc |
8764100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 10173028 - 10172970
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
10173028 |
tctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaagc |
10172970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10422839 - 10422897
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
10422839 |
tctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaagc |
10422897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11397946 - 11397888
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
11397946 |
tctacgcatgagtcggattagtcgtccacctttggtgggtcggaaatcggtgcgaaagc |
11397888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 17642061 - 17642003
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
17642061 |
tctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
17642003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 26660189 - 26660246
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
26660189 |
tctacgcatgagccggattagtcgcc-acctttggtgggtcggaaaccggtgcgaaagc |
26660246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 41663913 - 41663855
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
41663913 |
tctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
41663855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 51437512 - 51437566
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| ||||||||| |
|
|
| T |
51437512 |
cgcatgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaaagc |
51437566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 5504082 - 5504139
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| | |||||| |
|
|
| T |
5504082 |
tctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaag |
5504139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 32922 - 32980
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| ||| |||||||||||| ||||||| |
|
|
| T |
32922 |
tctacgcatgagccgaattagtcgtctacttttgatggatcggaaaccgatacgaaagc |
32980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 10507749 - 10507807
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||| || ||||||| |
|
|
| T |
10507749 |
tctacgcatgagccggattagtcgtccaccactggtgggtcggaaaccaattcgaaagc |
10507807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 30927784 - 30927726
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| ||||||| ||| ||||| |
|
|
| T |
30927784 |
tctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgcaaaagc |
30927726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34697386 - 34697444
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| | || |||| ||||| |||||||||||||||||| |
|
|
| T |
34697386 |
tctacgcatgagccggattagtcgcccacttttgatgggttggaaaccgatgcgaaagc |
34697444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 35211229 - 35211171
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||||||||| || |||||| |
|
|
| T |
35211229 |
tctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaaagc |
35211171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 49078165 - 49078223
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |||||||||||| ||||||||| |
|
|
| T |
49078165 |
tctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaagc |
49078223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 14254323 - 14254278
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
14254323 |
tacgcatgagccggattagtcgtccacctttgatgggtcggaaacc |
14254278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 45361938 - 45361881
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
45361938 |
ctacgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
45361881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 32142901 - 32142845
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
32142901 |
tacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaagc |
32142845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 59
Target Start/End: Original strand, 37339874 - 37339929
Alignment:
| Q |
4 |
acgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||||| |||||||| ||||||||| |
|
|
| T |
37339874 |
acgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc |
37339929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 892355 - 892301
Alignment:
| Q |
5 |
cgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||| || ||||||||| |
|
|
| T |
892355 |
cgcatgagccggattagtcgcccacctttggtggatcggaaatcggtgcgaaagc |
892301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43959878 - 43959820
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||| |||| |||||||||| ||||||||| |
|
|
| T |
43959878 |
tctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc |
43959820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 50094955 - 50095013
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| || ||||||||||||||| ||| ||||| |
|
|
| T |
50094955 |
tctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgcaaaagc |
50095013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 50503418 - 50503360
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||| |||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
50503418 |
tctacgcacgagccggatttgtcgcccaccaatggtgggtcggaaaccgatgcgaaagc |
50503360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 59
Target Start/End: Complemental strand, 1764253 - 1764196
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||| | |||||||||| ||||||||||| |
|
|
| T |
1764253 |
ctacgcatgaggcggattagtcgcccacctttgataggtcggaaactgatgcgaaagc |
1764196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 44969716 - 44969773
Alignment:
| Q |
2 |
ctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||||| |||||||||| || |||||| |
|
|
| T |
44969716 |
ctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaagc |
44969773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 45726490 - 45726433
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| || | |||||||| |
|
|
| T |
45726490 |
tctacgcatgagccggattagtcgttcacctttggtggatcggagactggtgcgaaag |
45726433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 10336567 - 10336619
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgc |
53 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||| ||| |||||||||| |
|
|
| T |
10336567 |
tctacgcatgagccggattaatcgtccacctttgatggatcgaaaaccgatgc |
10336619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 32150977 - 32150921
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
32150977 |
tacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccgatgcgaaagc |
32150921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 46929789 - 46929737
Alignment:
| Q |
7 |
catgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||| || |||| ||| ||| |||||||||||||||| |
|
|
| T |
46929789 |
catgagccggattagtcgtccacttttgatggatcgaaaaccgatgcgaaagc |
46929737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33418172 - 33418125
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
33418172 |
tctatgcacgagccggattagtcgtccacctttggtcggtcggaaacc |
33418125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 35908809 - 35908865
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | ||||||||||||||| ||| ||||| |
|
|
| T |
35908809 |
tctacgcatgagccggattagtcgtccaccat--gtgggtcggaaaccggtgcaaaagc |
35908865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3850799 - 3850741
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||| ||||||||||| | |||||| |||||||||||||| ||||||||| |
|
|
| T |
3850799 |
tctacgcacgaggcggattagtcgcccacctttaatgggtcggaaaccggtgcgaaagc |
3850741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 16956517 - 16956575
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
16956517 |
tctacgcacgagccggattagtcactcacctttggtgggtcggaaaccagtgcgaaagc |
16956575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 17092534 - 17092480
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcga |
55 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| | || ||||||| ||||| |
|
|
| T |
17092534 |
tctacgcacgagccggattagtcgtccacctttggtagatcagaaaccggtgcga |
17092480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18915918 - 18915976
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||| |||||||| ||||||||| |
|
|
| T |
18915918 |
tctacgcacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaagc |
18915976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 33498896 - 33498838
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| ||| ||| || | ||||||| |
|
|
| T |
33498896 |
tctacgcatgagccggattagtcgtccacctttgatggatcgtaaagcggtacgaaagc |
33498838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 14357806 - 14357863
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| || |||||||| |||| |||| ||| |||||||||||||| |||||||| |
|
|
| T |
14357806 |
tctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaag |
14357863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31576604 - 31576547
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||||||| ||||||||| | ||||| || ||||||||||| ||| |||| |
|
|
| T |
31576604 |
tctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgcaaaag |
31576547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 48761227 - 48761272
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaa |
46 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
48761227 |
tctacgcacgagctggattagtcgtccacctttggtcggtcggaaa |
48761272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 50371891 - 50371834
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| |||||||||||||| | | ||||||||| |||||||||| |||||||| |
|
|
| T |
50371891 |
tctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag |
50371834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 6899619 - 6899667
Alignment:
| Q |
11 |
agccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| | ||||||| ||| |||||||||| ||||||||| |
|
|
| T |
6899619 |
agccggattagtcgcccacctttgatggatcggaaaccggtgcgaaagc |
6899667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 25178623 - 25178575
Alignment:
| Q |
11 |
agccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||| ||||||| |
|
|
| T |
25178623 |
agccggattagtcgttcacctttagtgggtcgaaaaccgatacgaaagc |
25178575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 47084231 - 47084175
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||||||||| | | || |||||||||| |||||||| ||||||||| |
|
|
| T |
47084231 |
tacgcatgagccggattagccacccacttttggtgggttggaaaccggtgcgaaagc |
47084175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 6908 - 6966
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
6908 |
tctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
6966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 8757 - 8699
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
8757 |
tctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
8699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 224370 - 224427
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
224370 |
tctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag |
224427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 186570 - 186618
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg |
49 |
Q |
| |
|
|||||||| |||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
186570 |
tctacgcacgagccggattagtcgttcatctttagtgggtcggaaaccg |
186618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 42888 - 42831
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
42888 |
tctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
42831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 9495 - 9551
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaa |
57 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
9495 |
tctacgcatgagccaaattagtcgtccacctttggtgggtcagaaaccggtgcgaaa |
9551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 155767 - 155709
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||||||| ||| ||||||||| |
|
|
| T |
155767 |
tctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaagc |
155709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 319475 - 319533
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
319475 |
tctatgcatgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaaagc |
319533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 623 - 681
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
623 |
tctacgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 6025 - 6077
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgc |
53 |
Q |
| |
|
|||||||||||| || |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
6025 |
tctacgcatgagacgaattagtcgtccaccattggtgggtcggaaaccgatgc |
6077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 9898 - 9945
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaacc |
48 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
9898 |
tctacgcacgagccggattagtcgtccacctttggtgggtcagaaacc |
9945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0316 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0316
Description:
Target: scaffold0316; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 1670 - 1612
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||| |||||| ||||||||| |
|
|
| T |
1670 |
tctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc |
1612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 68567 - 68621
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcga |
55 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||| |||||| ||||| |
|
|
| T |
68567 |
tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga |
68621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 16932 - 16989
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
16932 |
tctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag |
16989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 8232 - 8274
Alignment:
| Q |
17 |
attagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
8232 |
attagtcgtccacctttggtaggtcggaaaccggtgcgaaagc |
8274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 41097 - 41155
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||| ||||||||||||||| | | |||||||| ||||||||||| | ||||||| |
|
|
| T |
41097 |
tctacgcacgagccggattagtcgcccatctttggtgagtcggaaaccggttcgaaagc |
41155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7891 - 7833
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
||||||||| ||| |||||||||| | ||||||||||| |||||||||| | ||||||| |
|
|
| T |
7891 |
tctacgcattagctggattagtcgcccacctttggtggatcggaaaccggtacgaaagc |
7833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 59
Target Start/End: Complemental strand, 95035 - 94978
Alignment:
| Q |
3 |
tacgcatgagccggattagtcgtctacc-tttggtgggtcggaaaccgatgcgaaagc |
59 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||||| || ||| ||||| |
|
|
| T |
95035 |
tacgcatgagccggattagtcgcccaccatttggtgggtcggaaatcggtgcaaaagc |
94978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 12723 - 12780
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| || |||||||||||| | ||||||| |||||| ||||||| |||||||| |
|
|
| T |
12723 |
tctacgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag |
12780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 58089 - 58032
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||| ||||| |||| |||||||| |
|
|
| T |
58089 |
tctacgcatgagttggattagtcgcctatctttggtggatcggataccggtgcgaaag |
58032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 25138 - 25195
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
||||||||||| | ||||| ||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
25138 |
tctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag |
25195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 250081 - 250024
Alignment:
| Q |
1 |
tctacgcatgagccggattagtcgtctacctttggtgggtcggaaaccgatgcgaaag |
58 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| || |||||||| |
|
|
| T |
250081 |
tctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag |
250024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University