View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18678_low_88 (Length: 207)
Name: NF18678_low_88
Description: NF18678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18678_low_88 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 149
Target Start/End: Original strand, 11835530 - 11835660
Alignment:
| Q |
19 |
ggacagtggaaaatgaaaggtttgtttgggagaaaacaatgttggagattgatggatcttttgtgttttgtgtgagacagtgaaggaaagtggtgtataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835530 |
ggacagtggaaaatgaaaggtttgtttgggagaaaacaatgttggagattgatggatcttttgtgttttgtgtgagacagtgaaggaaagtggtgtataa |
11835629 |
T |
|
| Q |
119 |
agaatctgtttttgttcttgcagccaaggat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11835630 |
agaatctgtttttgttcttgcagccaaggat |
11835660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 25 - 128
Target Start/End: Complemental strand, 11820828 - 11820725
Alignment:
| Q |
25 |
tggaaaatgaaaggtttgtttgggagaaaacaatgttggagattgatggatcttttgtgttttgtgtgagacagtgaaggaaagtggtgtataaagaatc |
124 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||| ||||||| | |||||||||||||||||||||| ||||||||||| ||||| || |
|
|
| T |
11820828 |
tggaaaatgaagtgtttgtttgagagaaaacaatgttggagattgttggatctgtgttgttttgtgtgagacagtgaagaaaagtggtgtacaaagattc |
11820729 |
T |
|
| Q |
125 |
tgtt |
128 |
Q |
| |
|
|||| |
|
|
| T |
11820728 |
tgtt |
11820725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University