View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18679_high_17 (Length: 238)
Name: NF18679_high_17
Description: NF18679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18679_high_17 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 102781 - 102996
Alignment:
| Q |
18 |
aaagggtatgttgattgggccacaaatattgcatatatatctgtattctcaattatttgaaagggtctgttgattgggctattagtttatattatgcatc |
117 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
102781 |
aaagggtctgttgattgggctacaaatattgcatacatatctgtattctcaattatttgaaagagtctgttgattgggctattagtttatattatgcatc |
102880 |
T |
 |
| Q |
118 |
cccttttttgcaattagttttaattgggtctgcaagggtctgttgattgggctaggctttacgtcccccaacttttctaatttttcctttttaattgtat |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
102881 |
tccttttttgcaattagttttgattgggtctgcaagggtctgttgattgggctaggctttacgtcccccaacttttctaa-----cctttttaatcgtat |
102975 |
T |
 |
| Q |
218 |
ctacatagggtgttgtagatt |
238 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
102976 |
ctacatagggtgttgcagatt |
102996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University