View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18679_high_18 (Length: 220)
Name: NF18679_high_18
Description: NF18679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18679_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 1753384 - 1753200
Alignment:
| Q |
18 |
atgaagttgcaatgaagataacccggtggtaccagggttgttaagctgatgaagctgtttatgaccacggcgaagtaaatattcaatgtattgaaaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1753384 |
atgaagttgcaatgaagataacccggtggtaccagggttgttaagctgatcaagctgtttatgaccacggcgaagtaaatattcaatgtattgaaaattc |
1753285 |
T |
 |
| Q |
118 |
ttcctatcaacttgttttgaattgtgacgaaattcttgagatactatggattctatgttgcggcgttcttcgtctggtttggaac |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
1753284 |
ttcctatcaacttcttttgaattgtgacgaaattcttgagatactatggattctatgttgcggcgttcttggtccggtttggaac |
1753200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University