View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18679_high_19 (Length: 216)
Name: NF18679_high_19
Description: NF18679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18679_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 28 - 199
Target Start/End: Original strand, 39934888 - 39935063
Alignment:
| Q |
28 |
ttaattatgtcaatattgcaaacaatttgagaaatttgaaccaaacaatgtcatacttgataaatatattagataaacaccgataaatgtttgccatatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934888 |
ttaattatgtcaatattgcaaacaatttgagaaatttgaaccaaacaatgtcatacttgataaatatattagataaacaccgataaatgtttgccatatt |
39934987 |
T |
 |
| Q |
128 |
taattagatctgataatgccca-nnnnnnngtgaaaggatctg---acgaccatatatcatgtggaagaaatatat |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39934988 |
taattagatctgataatgcccattttttttgtgaaaggatctgacaacgaccatatatcatgtggaagaaatatat |
39935063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University