View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18679_high_20 (Length: 204)

Name: NF18679_high_20
Description: NF18679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18679_high_20
NF18679_high_20
[»] chr1 (1 HSPs)
chr1 (100-187)||(9950129-9950216)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 100 - 187
Target Start/End: Original strand, 9950129 - 9950216
Alignment:
100 caagggtaatcactaatccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtaatacacaatac 187  Q
    |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
9950129 caagggtaatcacttagccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtactacacaatac 9950216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University