View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18679_low_22 (Length: 216)

Name: NF18679_low_22
Description: NF18679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18679_low_22
NF18679_low_22
[»] chr4 (1 HSPs)
chr4 (28-199)||(39934888-39935063)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 28 - 199
Target Start/End: Original strand, 39934888 - 39935063
Alignment:
28 ttaattatgtcaatattgcaaacaatttgagaaatttgaaccaaacaatgtcatacttgataaatatattagataaacaccgataaatgtttgccatatt 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39934888 ttaattatgtcaatattgcaaacaatttgagaaatttgaaccaaacaatgtcatacttgataaatatattagataaacaccgataaatgtttgccatatt 39934987  T
128 taattagatctgataatgccca-nnnnnnngtgaaaggatctg---acgaccatatatcatgtggaagaaatatat 199  Q
    ||||||||||||||||||||||        |||||||||||||   ||||||||||||||||||||||||||||||    
39934988 taattagatctgataatgcccattttttttgtgaaaggatctgacaacgaccatatatcatgtggaagaaatatat 39935063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University