View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1867_high_19 (Length: 304)
Name: NF1867_high_19
Description: NF1867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1867_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 31 - 170
Target Start/End: Complemental strand, 16972802 - 16972663
Alignment:
| Q |
31 |
caacatcaaccataataaccgcttctctctttctctcactaaaccaacttcttcatcctttctcatcataacagcttcttctaacaacaataccatgctt |
130 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16972802 |
caacagcaacaataataaccgcttctctctttctctcactaaaccaacttcttcatcctttctcatcataacagcttcttctaacgacaataccatgctt |
16972703 |
T |
|
| Q |
131 |
cctccttacaacgttttgattactggctcaaccaaaggtc |
170 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16972702 |
cctccttataacgttttgattactggctcaaccaaaggtc |
16972663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University