View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1867_low_24 (Length: 255)
Name: NF1867_low_24
Description: NF1867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1867_low_24 |
 |  |
|
| [»] scaffold0317 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0317 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 174
Target Start/End: Complemental strand, 19791 - 19638
Alignment:
| Q |
21 |
gttagagtttagtacaaatcttttatatctaatcctagctagctaacattcaaaccctaatcccacttaacttaacctaattttttggcgccccctatcc |
120 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19791 |
gttagagtttagtacatatcttttatatctaatcctagctagctaacatccaaaccctaatcccacttaacttaacctaattttttggcgccccctatcc |
19692 |
T |
 |
| Q |
121 |
ccaaaatttgaatttcaatctcattcttgaaaccctgatagtctccatcaatcc |
174 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19691 |
ccaaaattttaatttcaaattcattcttgaaaccctgatagtctccatcaatcc |
19638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University